FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638961_at:

>probe:Drosophila_2:1638961_at:37:257; Interrogation_Position=228; Antisense; CAAAGTCATTGCTATGCCGGGCAGC
>probe:Drosophila_2:1638961_at:153:557; Interrogation_Position=288; Antisense; GGACGTGCCAGAAACAGACCCAGAT
>probe:Drosophila_2:1638961_at:601:117; Interrogation_Position=320; Antisense; AGCTCACAGTGTCACAGTCGCAGTC
>probe:Drosophila_2:1638961_at:467:87; Interrogation_Position=341; Antisense; AGTCCTCATCCACCGTTGCAAGAAG
>probe:Drosophila_2:1638961_at:110:133; Interrogation_Position=352; Antisense; ACCGTTGCAAGAAGGCGTCTCGCCG
>probe:Drosophila_2:1638961_at:94:433; Interrogation_Position=376; Antisense; GAGGGCTGCACCAGTCTTATGTACG
>probe:Drosophila_2:1638961_at:344:645; Interrogation_Position=390; Antisense; TCTTATGTACGCCTGTCAGCGAGGC
>probe:Drosophila_2:1638961_at:89:497; Interrogation_Position=404; Antisense; GTCAGCGAGGCGACATTGTCCAAGT
>probe:Drosophila_2:1638961_at:209:403; Interrogation_Position=415; Antisense; GACATTGTCCAAGTGTTGGCCCAAA
>probe:Drosophila_2:1638961_at:528:513; Interrogation_Position=427; Antisense; GTGTTGGCCCAAATGCGCGAAAAGA
>probe:Drosophila_2:1638961_at:442:623; Interrogation_Position=440; Antisense; TGCGCGAAAAGATACCCTACACTCT
>probe:Drosophila_2:1638961_at:190:667; Interrogation_Position=457; Antisense; TACACTCTCGCATTACAACACGTGT
>probe:Drosophila_2:1638961_at:307:371; Interrogation_Position=75; Antisense; GAAGGCCGCCAAAAAGCAGTTGCAG
>probe:Drosophila_2:1638961_at:350:91; Interrogation_Position=92; Antisense; AGTTGCAGTTCGAGAGTCCGCTGCC

Paste this into a BLAST search page for me
CAAAGTCATTGCTATGCCGGGCAGCGGACGTGCCAGAAACAGACCCAGATAGCTCACAGTGTCACAGTCGCAGTCAGTCCTCATCCACCGTTGCAAGAAGACCGTTGCAAGAAGGCGTCTCGCCGGAGGGCTGCACCAGTCTTATGTACGTCTTATGTACGCCTGTCAGCGAGGCGTCAGCGAGGCGACATTGTCCAAGTGACATTGTCCAAGTGTTGGCCCAAAGTGTTGGCCCAAATGCGCGAAAAGATGCGCGAAAAGATACCCTACACTCTTACACTCTCGCATTACAACACGTGTGAAGGCCGCCAAAAAGCAGTTGCAGAGTTGCAGTTCGAGAGTCCGCTGCC

Full Affymetrix probeset data:

Annotations for 1638961_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720