FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638962_at:

>probe:Drosophila_2:1638962_at:664:369; Interrogation_Position=3719; Antisense; GAAGGTCACGTCCAAGGAGGCACTC
>probe:Drosophila_2:1638962_at:524:547; Interrogation_Position=3734; Antisense; GGAGGCACTCGCTCAGATCTCTGAG
>probe:Drosophila_2:1638962_at:181:607; Interrogation_Position=3755; Antisense; TGAGTACTCGGAGGCAGGTCTCACC
>probe:Drosophila_2:1638962_at:690:79; Interrogation_Position=3770; Antisense; AGGTCTCACCGTACGTGGCACATAT
>probe:Drosophila_2:1638962_at:664:367; Interrogation_Position=3809; Antisense; GAATCCGCCGGATGGCGAGCGCAAA
>probe:Drosophila_2:1638962_at:61:635; Interrogation_Position=3841; Antisense; TCGCCATCGAGAGCTGCAGTGAACT
>probe:Drosophila_2:1638962_at:718:509; Interrogation_Position=3870; Antisense; GTGCAGAAGGCCAAGCGCGAGATCA
>probe:Drosophila_2:1638962_at:180:97; Interrogation_Position=3889; Antisense; AGATCACGCGGCTAATCAAGGAGGA
>probe:Drosophila_2:1638962_at:231:281; Interrogation_Position=3929; Antisense; CTCCGCTCATCATGTCTTTAACAAG
>probe:Drosophila_2:1638962_at:196:159; Interrogation_Position=3949; Antisense; ACAAGGGTCGCTACAAGGTGGTCTA
>probe:Drosophila_2:1638962_at:452:277; Interrogation_Position=4030; Antisense; CTTTAGAGCGCGATCAGATAGGCAT
>probe:Drosophila_2:1638962_at:168:3; Interrogation_Position=4119; Antisense; ATTGGATACACGCACTTTGTTTACA
>probe:Drosophila_2:1638962_at:484:689; Interrogation_Position=4134; Antisense; TTTGTTTACAACGTGGTCTAGACCT
>probe:Drosophila_2:1638962_at:453:277; Interrogation_Position=4216; Antisense; CTTTGGAGCGCGATCAGATAGGCAT

Paste this into a BLAST search page for me
GAAGGTCACGTCCAAGGAGGCACTCGGAGGCACTCGCTCAGATCTCTGAGTGAGTACTCGGAGGCAGGTCTCACCAGGTCTCACCGTACGTGGCACATATGAATCCGCCGGATGGCGAGCGCAAATCGCCATCGAGAGCTGCAGTGAACTGTGCAGAAGGCCAAGCGCGAGATCAAGATCACGCGGCTAATCAAGGAGGACTCCGCTCATCATGTCTTTAACAAGACAAGGGTCGCTACAAGGTGGTCTACTTTAGAGCGCGATCAGATAGGCATATTGGATACACGCACTTTGTTTACATTTGTTTACAACGTGGTCTAGACCTCTTTGGAGCGCGATCAGATAGGCAT

Full Affymetrix probeset data:

Annotations for 1638962_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720