Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638965_at:

>probe:Drosophila_2:1638965_at:78:355; Interrogation_Position=2711; Antisense; GCACCATGCCGCTGCAGAGAAATGT
>probe:Drosophila_2:1638965_at:268:169; Interrogation_Position=2730; Antisense; AAATGTGGCCGACGACTACGTGATC
>probe:Drosophila_2:1638965_at:317:251; Interrogation_Position=2757; Antisense; CAAGATGATTCGATGTGCCGCCAAT
>probe:Drosophila_2:1638965_at:709:237; Interrogation_Position=2779; Antisense; AATCTGGGCTGTCACATGCAGGCCA
>probe:Drosophila_2:1638965_at:579:471; Interrogation_Position=2806; Antisense; GTTCTGTGTCAGTTCCTTGATGAGA
>probe:Drosophila_2:1638965_at:343:449; Interrogation_Position=2829; Antisense; GATCGACTACGGCATTGTGTTCAAG
>probe:Drosophila_2:1638965_at:40:293; Interrogation_Position=2870; Antisense; CGTCGAATTTCACCGATGCCATGGA
>probe:Drosophila_2:1638965_at:219:271; Interrogation_Position=2910; Antisense; CATCTGGGATACAACTCTGCTGGAG
>probe:Drosophila_2:1638965_at:359:637; Interrogation_Position=2925; Antisense; TCTGCTGGAGTTCATCGTCAATCTG
>probe:Drosophila_2:1638965_at:194:639; Interrogation_Position=2939; Antisense; TCGTCAATCTGCACGCTAAGCGAGG
>probe:Drosophila_2:1638965_at:191:379; Interrogation_Position=2983; Antisense; GAAGCGATTTCTATGATGGGCACTC
>probe:Drosophila_2:1638965_at:74:65; Interrogation_Position=2998; Antisense; ATGGGCACTCTGGAGCTGAATGCAA
>probe:Drosophila_2:1638965_at:261:135; Interrogation_Position=3042; Antisense; ACGAGAATCTGCCATGGTGCGGAAA
>probe:Drosophila_2:1638965_at:657:165; Interrogation_Position=3064; Antisense; AAATCGAGATTTCTGCGTGCCCTGG

Paste this into a BLAST search page for me
GCACCATGCCGCTGCAGAGAAATGTAAATGTGGCCGACGACTACGTGATCCAAGATGATTCGATGTGCCGCCAATAATCTGGGCTGTCACATGCAGGCCAGTTCTGTGTCAGTTCCTTGATGAGAGATCGACTACGGCATTGTGTTCAAGCGTCGAATTTCACCGATGCCATGGACATCTGGGATACAACTCTGCTGGAGTCTGCTGGAGTTCATCGTCAATCTGTCGTCAATCTGCACGCTAAGCGAGGGAAGCGATTTCTATGATGGGCACTCATGGGCACTCTGGAGCTGAATGCAAACGAGAATCTGCCATGGTGCGGAAAAAATCGAGATTTCTGCGTGCCCTGG

Full Affymetrix probeset data:

Annotations for 1638965_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime