FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638966_at:

>probe:Drosophila_2:1638966_at:655:139; Interrogation_Position=430; Antisense; ACGTCGCGGCGCAGTGTGAATTTTA
>probe:Drosophila_2:1638966_at:225:501; Interrogation_Position=432; Antisense; GTCGCGGCGCAGTGTGAATTTTAGC
>probe:Drosophila_2:1638966_at:401:515; Interrogation_Position=443; Antisense; GTGTGAATTTTAGCGCTTGTCCATA
>probe:Drosophila_2:1638966_at:106:699; Interrogation_Position=451; Antisense; TTTAGCGCTTGTCCATAAAACGCGA
>probe:Drosophila_2:1638966_at:686:321; Interrogation_Position=455; Antisense; GCGCTTGTCCATAAAACGCGAACAG
>probe:Drosophila_2:1638966_at:166:727; Interrogation_Position=459; Antisense; TTGTCCATAAAACGCGAACAGCCAG
>probe:Drosophila_2:1638966_at:276:177; Interrogation_Position=467; Antisense; AAAACGCGAACAGCCAGTTTAATCG
>probe:Drosophila_2:1638966_at:389:155; Interrogation_Position=476; Antisense; ACAGCCAGTTTAATCGCTTTTCCTC
>probe:Drosophila_2:1638966_at:507:265; Interrogation_Position=481; Antisense; CAGTTTAATCGCTTTTCCTCTCTAA
>probe:Drosophila_2:1638966_at:680:709; Interrogation_Position=485; Antisense; TTAATCGCTTTTCCTCTCTAAATTG
>probe:Drosophila_2:1638966_at:148:231; Interrogation_Position=487; Antisense; AATCGCTTTTCCTCTCTAAATTGAA
>probe:Drosophila_2:1638966_at:600:623; Interrogation_Position=496; Antisense; TCCTCTCTAAATTGAATCCGTCCGT
>probe:Drosophila_2:1638966_at:366:663; Interrogation_Position=503; Antisense; TAAATTGAATCCGTCCGTAGGCCTC
>probe:Drosophila_2:1638966_at:304:703; Interrogation_Position=507; Antisense; TTGAATCCGTCCGTAGGCCTCCGTT

Paste this into a BLAST search page for me
ACGTCGCGGCGCAGTGTGAATTTTAGTCGCGGCGCAGTGTGAATTTTAGCGTGTGAATTTTAGCGCTTGTCCATATTTAGCGCTTGTCCATAAAACGCGAGCGCTTGTCCATAAAACGCGAACAGTTGTCCATAAAACGCGAACAGCCAGAAAACGCGAACAGCCAGTTTAATCGACAGCCAGTTTAATCGCTTTTCCTCCAGTTTAATCGCTTTTCCTCTCTAATTAATCGCTTTTCCTCTCTAAATTGAATCGCTTTTCCTCTCTAAATTGAATCCTCTCTAAATTGAATCCGTCCGTTAAATTGAATCCGTCCGTAGGCCTCTTGAATCCGTCCGTAGGCCTCCGTT

Full Affymetrix probeset data:

Annotations for 1638966_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720