FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638967_at:

>probe:Drosophila_2:1638967_at:137:477; Interrogation_Position=424; Antisense; GTTATCCGATATAAATCCACCCGTC
>probe:Drosophila_2:1638967_at:344:29; Interrogation_Position=456; Antisense; ATACACCCTTCTTGCTAATATCTGG
>probe:Drosophila_2:1638967_at:721:219; Interrogation_Position=548; Antisense; AAGGTGCCCGGACAGGTTCCATTGA
>probe:Drosophila_2:1638967_at:706:599; Interrogation_Position=596; Antisense; TGATAGCCATTGCAGTTGTCCGTGT
>probe:Drosophila_2:1638967_at:98:93; Interrogation_Position=609; Antisense; AGTTGTCCGTGTCCTTGACGAAGAC
>probe:Drosophila_2:1638967_at:57:49; Interrogation_Position=647; Antisense; ATGTTGCAATAGCTATCCGGGTCCA
>probe:Drosophila_2:1638967_at:312:45; Interrogation_Position=661; Antisense; ATCCGGGTCCATTTTATTCGAGCAC
>probe:Drosophila_2:1638967_at:443:267; Interrogation_Position=701; Antisense; CAGTCCTGCGTTCCCGAATTGAAAT
>probe:Drosophila_2:1638967_at:399:395; Interrogation_Position=721; Antisense; GAAATTCATCCCAGTGTTGCACACT
>probe:Drosophila_2:1638967_at:488:123; Interrogation_Position=826; Antisense; AGCGCACGGATCACTGGACAGACAC
>probe:Drosophila_2:1638967_at:650:585; Interrogation_Position=861; Antisense; TGGAACTCAGGCATTTCTGGCTCTC
>probe:Drosophila_2:1638967_at:83:677; Interrogation_Position=893; Antisense; TAGAAGAGTCCAGTCGCACAGCTAC
>probe:Drosophila_2:1638967_at:305:43; Interrogation_Position=934; Antisense; ATCGATGCACTGAATCCACGCGTTG
>probe:Drosophila_2:1638967_at:376:451; Interrogation_Position=969; Antisense; GATCGTTCATCTTGGTTCCGTTGAC

Paste this into a BLAST search page for me
GTTATCCGATATAAATCCACCCGTCATACACCCTTCTTGCTAATATCTGGAAGGTGCCCGGACAGGTTCCATTGATGATAGCCATTGCAGTTGTCCGTGTAGTTGTCCGTGTCCTTGACGAAGACATGTTGCAATAGCTATCCGGGTCCAATCCGGGTCCATTTTATTCGAGCACCAGTCCTGCGTTCCCGAATTGAAATGAAATTCATCCCAGTGTTGCACACTAGCGCACGGATCACTGGACAGACACTGGAACTCAGGCATTTCTGGCTCTCTAGAAGAGTCCAGTCGCACAGCTACATCGATGCACTGAATCCACGCGTTGGATCGTTCATCTTGGTTCCGTTGAC

Full Affymetrix probeset data:

Annotations for 1638967_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720