Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638968_at:

>probe:Drosophila_2:1638968_at:497:531; Interrogation_Position=1844; Antisense; GGTGGCCATTCCTTTAGGTGCTAAG
>probe:Drosophila_2:1638968_at:264:539; Interrogation_Position=1872; Antisense; GGTACAAGACTTATATGCGCCCTCA
>probe:Drosophila_2:1638968_at:27:373; Interrogation_Position=1907; Antisense; GAAGGTCACCCATTTTGACTGTCGC
>probe:Drosophila_2:1638968_at:225:635; Interrogation_Position=1928; Antisense; TCGCGACTGCGACTTGGACGAGCAA
>probe:Drosophila_2:1638968_at:394:383; Interrogation_Position=1967; Antisense; GAACGTGGCAGTCAGGCGAAACATT
>probe:Drosophila_2:1638968_at:486:643; Interrogation_Position=1993; Antisense; TCTTGGGCGAAAACGGCTTTGTCAC
>probe:Drosophila_2:1638968_at:667:341; Interrogation_Position=2008; Antisense; GCTTTGTCACCGATACACAGCGCTT
>probe:Drosophila_2:1638968_at:253:713; Interrogation_Position=2031; Antisense; TTCCCCAGCATTGGCGATGTTTTGG
>probe:Drosophila_2:1638968_at:304:411; Interrogation_Position=2066; Antisense; GACGCTGAAGCATCCGATGGTGCAA
>probe:Drosophila_2:1638968_at:728:209; Interrogation_Position=2115; Antisense; AAGAAGGAGTGCTTGCCGTTCTGCC
>probe:Drosophila_2:1638968_at:680:353; Interrogation_Position=2250; Antisense; GCACCTCCGGTCGAAGAGCTAGTGA
>probe:Drosophila_2:1638968_at:31:219; Interrogation_Position=2278; Antisense; AAGTCAGTTCAGTGTCGGTGATCAA
>probe:Drosophila_2:1638968_at:481:103; Interrogation_Position=2339; Antisense; AGACGAGTTCCGAGCTCACGTTTTT
>probe:Drosophila_2:1638968_at:301:153; Interrogation_Position=2380; Antisense; ACAGGCACTCCTACTTCATGAAAGA

Paste this into a BLAST search page for me
GGTGGCCATTCCTTTAGGTGCTAAGGGTACAAGACTTATATGCGCCCTCAGAAGGTCACCCATTTTGACTGTCGCTCGCGACTGCGACTTGGACGAGCAAGAACGTGGCAGTCAGGCGAAACATTTCTTGGGCGAAAACGGCTTTGTCACGCTTTGTCACCGATACACAGCGCTTTTCCCCAGCATTGGCGATGTTTTGGGACGCTGAAGCATCCGATGGTGCAAAAGAAGGAGTGCTTGCCGTTCTGCCGCACCTCCGGTCGAAGAGCTAGTGAAAGTCAGTTCAGTGTCGGTGATCAAAGACGAGTTCCGAGCTCACGTTTTTACAGGCACTCCTACTTCATGAAAGA

Full Affymetrix probeset data:

Annotations for 1638968_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime