Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638969_at:

>probe:Drosophila_2:1638969_at:518:667; Interrogation_Position=1960; Antisense; TACTGCGTCGTACAGGAGCCGGAAC
>probe:Drosophila_2:1638969_at:632:561; Interrogation_Position=1980; Antisense; GGAACTCAAGCGATCCATTCGGGAA
>probe:Drosophila_2:1638969_at:188:445; Interrogation_Position=2043; Antisense; GATGCATCCGCAGTGGGTCACCGAT
>probe:Drosophila_2:1638969_at:183:225; Interrogation_Position=2095; Antisense; AAGGAGTATCTCACCGAGGCGCCGT
>probe:Drosophila_2:1638969_at:220:439; Interrogation_Position=2110; Antisense; GAGGCGCCGTACCTTATACTGATCT
>probe:Drosophila_2:1638969_at:720:141; Interrogation_Position=2127; Antisense; ACTGATCTTCAAGCAGACCTATGGA
>probe:Drosophila_2:1638969_at:34:25; Interrogation_Position=2197; Antisense; ATATCCACTTCGATTGCGGCCGGTA
>probe:Drosophila_2:1638969_at:183:539; Interrogation_Position=2218; Antisense; GGTATCCTTTTGTGTGCCCTTCAAG
>probe:Drosophila_2:1638969_at:571:689; Interrogation_Position=2274; Antisense; TTTGAACTGCGGTCCAGCCTTGAGA
>probe:Drosophila_2:1638969_at:335:127; Interrogation_Position=2289; Antisense; AGCCTTGAGAAACCTGCTCGGGCGA
>probe:Drosophila_2:1638969_at:721:387; Interrogation_Position=2323; Antisense; GAAAAATTACTCATCCTACTGCCCG
>probe:Drosophila_2:1638969_at:426:665; Interrogation_Position=2339; Antisense; TACTGCCCGTTGGTTATCCGAAAGA
>probe:Drosophila_2:1638969_at:99:357; Interrogation_Position=2369; Antisense; GCACAGTTCCCGACTTGGCGAGAAA
>probe:Drosophila_2:1638969_at:424:655; Interrogation_Position=2429; Antisense; TATTTACGTCCGTGCAGCTTACGAA

Paste this into a BLAST search page for me
TACTGCGTCGTACAGGAGCCGGAACGGAACTCAAGCGATCCATTCGGGAAGATGCATCCGCAGTGGGTCACCGATAAGGAGTATCTCACCGAGGCGCCGTGAGGCGCCGTACCTTATACTGATCTACTGATCTTCAAGCAGACCTATGGAATATCCACTTCGATTGCGGCCGGTAGGTATCCTTTTGTGTGCCCTTCAAGTTTGAACTGCGGTCCAGCCTTGAGAAGCCTTGAGAAACCTGCTCGGGCGAGAAAAATTACTCATCCTACTGCCCGTACTGCCCGTTGGTTATCCGAAAGAGCACAGTTCCCGACTTGGCGAGAAATATTTACGTCCGTGCAGCTTACGAA

Full Affymetrix probeset data:

Annotations for 1638969_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime