FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638970_at:

>probe:Drosophila_2:1638970_at:175:395; Interrogation_Position=164; Antisense; GAAATCATGGACTACACCTACCAGT
>probe:Drosophila_2:1638970_at:561:673; Interrogation_Position=182; Antisense; TACCAGTACTGCGTGTCCAACGAAA
>probe:Drosophila_2:1638970_at:68:577; Interrogation_Position=249; Antisense; TGGACCAGGAGTTTAACACCCTCTG
>probe:Drosophila_2:1638970_at:533:409; Interrogation_Position=275; Antisense; GACGACGACTCCATTCCGGAGATCT
>probe:Drosophila_2:1638970_at:596:97; Interrogation_Position=294; Antisense; AGATCTGCCGGAATCTGCTGCGCTA
>probe:Drosophila_2:1638970_at:590:621; Interrogation_Position=309; Antisense; TGCTGCGCTACAAATTGATGGCCCA
>probe:Drosophila_2:1638970_at:104:725; Interrogation_Position=323; Antisense; TTGATGGCCCAGCAGAACCAGTTTC
>probe:Drosophila_2:1638970_at:13:249; Interrogation_Position=363; Antisense; AATTGAGTAAACTTCCTGCTGGCAA
>probe:Drosophila_2:1638970_at:155:335; Interrogation_Position=394; Antisense; GCTGCGTCCGGATGTTAAGATCACC
>probe:Drosophila_2:1638970_at:411:59; Interrogation_Position=405; Antisense; ATGTTAAGATCACCTACACACCCAT
>probe:Drosophila_2:1638970_at:441:437; Interrogation_Position=506; Antisense; GAGGAAACTCCCAGCGGCAGTGGTC
>probe:Drosophila_2:1638970_at:156:611; Interrogation_Position=534; Antisense; TGACGCGATCGCAGGCACGAAAGCA
>probe:Drosophila_2:1638970_at:471:573; Interrogation_Position=590; Antisense; GGCTGGACCACCGTGCGAAGAAAAT
>probe:Drosophila_2:1638970_at:319:375; Interrogation_Position=82; Antisense; GAAGATCTTCAATCACTGGCAGGAT

Paste this into a BLAST search page for me
GAAATCATGGACTACACCTACCAGTTACCAGTACTGCGTGTCCAACGAAATGGACCAGGAGTTTAACACCCTCTGGACGACGACTCCATTCCGGAGATCTAGATCTGCCGGAATCTGCTGCGCTATGCTGCGCTACAAATTGATGGCCCATTGATGGCCCAGCAGAACCAGTTTCAATTGAGTAAACTTCCTGCTGGCAAGCTGCGTCCGGATGTTAAGATCACCATGTTAAGATCACCTACACACCCATGAGGAAACTCCCAGCGGCAGTGGTCTGACGCGATCGCAGGCACGAAAGCAGGCTGGACCACCGTGCGAAGAAAATGAAGATCTTCAATCACTGGCAGGAT

Full Affymetrix probeset data:

Annotations for 1638970_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720