FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638972_at:

>probe:Drosophila_2:1638972_at:574:79; Interrogation_Position=1043; Antisense; AGGTGTTTCCCGCTGAGTTGCCATA
>probe:Drosophila_2:1638972_at:486:721; Interrogation_Position=1060; Antisense; TTGCCATATGCCGTGGAGTCCGATA
>probe:Drosophila_2:1638972_at:479:519; Interrogation_Position=1072; Antisense; GTGGAGTCCGATAGGGCCGAACATC
>probe:Drosophila_2:1638972_at:526:83; Interrogation_Position=1084; Antisense; AGGGCCGAACATCCGGAGGCATCAA
>probe:Drosophila_2:1638972_at:729:569; Interrogation_Position=1101; Antisense; GGCATCAACCGCTCGATTGGGCATA
>probe:Drosophila_2:1638972_at:71:467; Interrogation_Position=1132; Antisense; GTTGTCCCCGTGACCATGACGAAAA
>probe:Drosophila_2:1638972_at:158:71; Interrogation_Position=1218; Antisense; AGTAACTATACGATTTGCCCGCCGG
>probe:Drosophila_2:1638972_at:653:299; Interrogation_Position=1235; Antisense; CCCGCCGGGAGTTCAGTTGGAGCAA
>probe:Drosophila_2:1638972_at:210:357; Interrogation_Position=1256; Antisense; GCAAAAGTTCAGTATCGGTATCGTA
>probe:Drosophila_2:1638972_at:544:483; Interrogation_Position=1273; Antisense; GTATCGTACTCCTATGACAACCAGA
>probe:Drosophila_2:1638972_at:22:101; Interrogation_Position=1295; Antisense; AGAGTATTGATACCCTTGACGAGAA
>probe:Drosophila_2:1638972_at:500:299; Interrogation_Position=1437; Antisense; CGCCCTCGCCATGGAGTTGATTAAA
>probe:Drosophila_2:1638972_at:543:453; Interrogation_Position=1493; Antisense; GATCAAGTCGTACTAATGTCCCGCA
>probe:Drosophila_2:1638972_at:651:503; Interrogation_Position=1531; Antisense; GTCCAGACCGACAGAAGCTACTTAA

Paste this into a BLAST search page for me
AGGTGTTTCCCGCTGAGTTGCCATATTGCCATATGCCGTGGAGTCCGATAGTGGAGTCCGATAGGGCCGAACATCAGGGCCGAACATCCGGAGGCATCAAGGCATCAACCGCTCGATTGGGCATAGTTGTCCCCGTGACCATGACGAAAAAGTAACTATACGATTTGCCCGCCGGCCCGCCGGGAGTTCAGTTGGAGCAAGCAAAAGTTCAGTATCGGTATCGTAGTATCGTACTCCTATGACAACCAGAAGAGTATTGATACCCTTGACGAGAACGCCCTCGCCATGGAGTTGATTAAAGATCAAGTCGTACTAATGTCCCGCAGTCCAGACCGACAGAAGCTACTTAA

Full Affymetrix probeset data:

Annotations for 1638972_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720