FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638974_at:

>probe:Drosophila_2:1638974_at:371:591; Interrogation_Position=212; Antisense; TGGTGCGCTACCTAATCAACGATGC
>probe:Drosophila_2:1638974_at:298:579; Interrogation_Position=246; Antisense; GGCCTTCGTGCGGATTATCAACAGC
>probe:Drosophila_2:1638974_at:448:685; Interrogation_Position=261; Antisense; TATCAACAGCAATGCCGCAGTCACT
>probe:Drosophila_2:1638974_at:103:647; Interrogation_Position=317; Antisense; TCATTCTCTTTCTGCAGTGGACGGA
>probe:Drosophila_2:1638974_at:505:431; Interrogation_Position=399; Antisense; GAGTCTATTGAACCAGTTTCCCTAC
>probe:Drosophila_2:1638974_at:673:191; Interrogation_Position=432; Antisense; CACCGTTTTCGGCTGGCAAGGATTT
>probe:Drosophila_2:1638974_at:594:197; Interrogation_Position=460; Antisense; AACGAAGTTCAGCTCTACTTTCCAC
>probe:Drosophila_2:1638974_at:252:669; Interrogation_Position=475; Antisense; TACTTTCCACTGTATGCCATCCGAG
>probe:Drosophila_2:1638974_at:374:113; Interrogation_Position=524; Antisense; AGCAGGGAATTTTCGCCCAGTTCTG
>probe:Drosophila_2:1638974_at:471:389; Interrogation_Position=601; Antisense; GAAACTACACAGGTTCTGGCTGAAC
>probe:Drosophila_2:1638974_at:187:227; Interrogation_Position=631; Antisense; AAGGCGGGCATTGATACCGTGCAAT
>probe:Drosophila_2:1638974_at:709:547; Interrogation_Position=657; Antisense; GGATGGCATCATCCGAGAGCTCCTC
>probe:Drosophila_2:1638974_at:46:119; Interrogation_Position=674; Antisense; AGCTCCTCGGCTGGAATGCTGTGAA
>probe:Drosophila_2:1638974_at:266:667; Interrogation_Position=702; Antisense; TACGGTAGAAGCCTCCACTGGTGGA

Paste this into a BLAST search page for me
TGGTGCGCTACCTAATCAACGATGCGGCCTTCGTGCGGATTATCAACAGCTATCAACAGCAATGCCGCAGTCACTTCATTCTCTTTCTGCAGTGGACGGAGAGTCTATTGAACCAGTTTCCCTACCACCGTTTTCGGCTGGCAAGGATTTAACGAAGTTCAGCTCTACTTTCCACTACTTTCCACTGTATGCCATCCGAGAGCAGGGAATTTTCGCCCAGTTCTGGAAACTACACAGGTTCTGGCTGAACAAGGCGGGCATTGATACCGTGCAATGGATGGCATCATCCGAGAGCTCCTCAGCTCCTCGGCTGGAATGCTGTGAATACGGTAGAAGCCTCCACTGGTGGA

Full Affymetrix probeset data:

Annotations for 1638974_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720