Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638975_at:

>probe:Drosophila_2:1638975_at:89:117; Interrogation_Position=322; Antisense; AGCATAGAGCTTTCCGGAGACCAGA
>probe:Drosophila_2:1638975_at:548:149; Interrogation_Position=346; Antisense; ACTTCCAGCTCACTTCATATTCAGA
>probe:Drosophila_2:1638975_at:606:435; Interrogation_Position=376; Antisense; GAGGATTATCCCATTCACACGATTG
>probe:Drosophila_2:1638975_at:25:327; Interrogation_Position=413; Antisense; GCGAGTGGTTCTTCGAACGCTTCAA
>probe:Drosophila_2:1638975_at:23:409; Interrogation_Position=442; Antisense; GACGCCCTTAGTCTGGTGGATTTAT
>probe:Drosophila_2:1638975_at:610:513; Interrogation_Position=544; Antisense; GTGTTATCGGCACTAACGAGCGCTA
>probe:Drosophila_2:1638975_at:489:667; Interrogation_Position=586; Antisense; TACTTTAATCCAAACCTGACGCACG
>probe:Drosophila_2:1638975_at:528:135; Interrogation_Position=604; Antisense; ACGCACGCCGGAATTCAGGGTCGAA
>probe:Drosophila_2:1638975_at:566:583; Interrogation_Position=629; Antisense; TGGACTCGTACGGACATTTCTTAGT
>probe:Drosophila_2:1638975_at:513:273; Interrogation_Position=643; Antisense; CATTTCTTAGTGATCTGCTGCGGCA
>probe:Drosophila_2:1638975_at:556:513; Interrogation_Position=680; Antisense; GTGATAGCTGCGTCGGAATCTTTGA
>probe:Drosophila_2:1638975_at:456:365; Interrogation_Position=695; Antisense; GAATCTTTGAATGTGCCTTCGGGCT
>probe:Drosophila_2:1638975_at:583:355; Interrogation_Position=804; Antisense; GCACTATCTGTGCTCGAGCGAAACT
>probe:Drosophila_2:1638975_at:542:87; Interrogation_Position=852; Antisense; AGTACCCTCTGATGACTTGAACTAG

Paste this into a BLAST search page for me
AGCATAGAGCTTTCCGGAGACCAGAACTTCCAGCTCACTTCATATTCAGAGAGGATTATCCCATTCACACGATTGGCGAGTGGTTCTTCGAACGCTTCAAGACGCCCTTAGTCTGGTGGATTTATGTGTTATCGGCACTAACGAGCGCTATACTTTAATCCAAACCTGACGCACGACGCACGCCGGAATTCAGGGTCGAATGGACTCGTACGGACATTTCTTAGTCATTTCTTAGTGATCTGCTGCGGCAGTGATAGCTGCGTCGGAATCTTTGAGAATCTTTGAATGTGCCTTCGGGCTGCACTATCTGTGCTCGAGCGAAACTAGTACCCTCTGATGACTTGAACTAG

Full Affymetrix probeset data:

Annotations for 1638975_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime