FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638980_at:

>probe:Drosophila_2:1638980_at:704:3; Interrogation_Position=184; Antisense; ATTGGCACTCGGGACTGGCAACTCA
>probe:Drosophila_2:1638980_at:199:111; Interrogation_Position=228; Antisense; AGCCACAAACTTCACACATTTCGGA
>probe:Drosophila_2:1638980_at:233:99; Interrogation_Position=323; Antisense; AGATGCCGGCGGACATAGTGACCAC
>probe:Drosophila_2:1638980_at:205:283; Interrogation_Position=367; Antisense; CTCGCCTTCAGTCATGCCATGGAAA
>probe:Drosophila_2:1638980_at:172:73; Interrogation_Position=400; Antisense; AGGCACTGGCAGGAGACCTTCGCGT
>probe:Drosophila_2:1638980_at:472:329; Interrogation_Position=421; Antisense; GCGTGGTACCCTAAGATGCAGTGCT
>probe:Drosophila_2:1638980_at:14:351; Interrogation_Position=438; Antisense; GCAGTGCTGCCATTATCAGCGGATT
>probe:Drosophila_2:1638980_at:338:263; Interrogation_Position=466; Antisense; CAGATCTATCTGACGAGTCGCCAGC
>probe:Drosophila_2:1638980_at:684:267; Interrogation_Position=528; Antisense; CAGGCGCCTGGCAAAGAAGTTCGTG
>probe:Drosophila_2:1638980_at:305:3; Interrogation_Position=613; Antisense; ATTACGGGCCTCAAAGTTGCGGTCA
>probe:Drosophila_2:1638980_at:670:89; Interrogation_Position=650; Antisense; AGTACGGCCGAATGAAGCCCTCCAA
>probe:Drosophila_2:1638980_at:324:125; Interrogation_Position=665; Antisense; AGCCCTCCAAGCTGTACATGTGCTA
>probe:Drosophila_2:1638980_at:351:63; Interrogation_Position=682; Antisense; ATGTGCTAGGACACCCTGTGACCAG
>probe:Drosophila_2:1638980_at:345:663; Interrogation_Position=751; Antisense; TAAACTATCATTCTCTGCTGACAAT

Paste this into a BLAST search page for me
ATTGGCACTCGGGACTGGCAACTCAAGCCACAAACTTCACACATTTCGGAAGATGCCGGCGGACATAGTGACCACCTCGCCTTCAGTCATGCCATGGAAAAGGCACTGGCAGGAGACCTTCGCGTGCGTGGTACCCTAAGATGCAGTGCTGCAGTGCTGCCATTATCAGCGGATTCAGATCTATCTGACGAGTCGCCAGCCAGGCGCCTGGCAAAGAAGTTCGTGATTACGGGCCTCAAAGTTGCGGTCAAGTACGGCCGAATGAAGCCCTCCAAAGCCCTCCAAGCTGTACATGTGCTAATGTGCTAGGACACCCTGTGACCAGTAAACTATCATTCTCTGCTGACAAT

Full Affymetrix probeset data:

Annotations for 1638980_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720