FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638981_at:

>probe:Drosophila_2:1638981_at:419:677; Interrogation_Position=1469; Antisense; TAGTTTCTGTTCTCTTCGGACGAAT
>probe:Drosophila_2:1638981_at:372:639; Interrogation_Position=1484; Antisense; TCGGACGAATCGGACTAAGTGCTAT
>probe:Drosophila_2:1638981_at:30:279; Interrogation_Position=1505; Antisense; CTATTATTGTTATCTTCCTCGGCTG
>probe:Drosophila_2:1638981_at:412:631; Interrogation_Position=1520; Antisense; TCCTCGGCTGGAAACTAGTCTCATT
>probe:Drosophila_2:1638981_at:490:211; Interrogation_Position=1551; Antisense; AAGACACCTTGAGTATCGATTGAAT
>probe:Drosophila_2:1638981_at:258:155; Interrogation_Position=1613; Antisense; ACAGCACATCCAAGACATGGCCAAT
>probe:Drosophila_2:1638981_at:126:67; Interrogation_Position=1629; Antisense; ATGGCCAATCGGCTACCTTTTGTTT
>probe:Drosophila_2:1638981_at:165:61; Interrogation_Position=1752; Antisense; ATGTACAGCCATGCGAATGTTCTAC
>probe:Drosophila_2:1638981_at:33:179; Interrogation_Position=1778; Antisense; AAACTTTACTTCATGATTCGCCTAT
>probe:Drosophila_2:1638981_at:340:463; Interrogation_Position=1792; Antisense; GATTCGCCTATCAGCATTACAGTTT
>probe:Drosophila_2:1638981_at:262:79; Interrogation_Position=1880; Antisense; AGGGAAATTTAATCGCCAGTATCGT
>probe:Drosophila_2:1638981_at:599:325; Interrogation_Position=1947; Antisense; GCGAGTTATCTAATCAGTCAGTTAA
>probe:Drosophila_2:1638981_at:314:93; Interrogation_Position=1966; Antisense; AGTTAAATGACCGTGGCGGCGCCAA
>probe:Drosophila_2:1638981_at:412:583; Interrogation_Position=1979; Antisense; TGGCGGCGCCAAACAAGTCTTTCAA

Paste this into a BLAST search page for me
TAGTTTCTGTTCTCTTCGGACGAATTCGGACGAATCGGACTAAGTGCTATCTATTATTGTTATCTTCCTCGGCTGTCCTCGGCTGGAAACTAGTCTCATTAAGACACCTTGAGTATCGATTGAATACAGCACATCCAAGACATGGCCAATATGGCCAATCGGCTACCTTTTGTTTATGTACAGCCATGCGAATGTTCTACAAACTTTACTTCATGATTCGCCTATGATTCGCCTATCAGCATTACAGTTTAGGGAAATTTAATCGCCAGTATCGTGCGAGTTATCTAATCAGTCAGTTAAAGTTAAATGACCGTGGCGGCGCCAATGGCGGCGCCAAACAAGTCTTTCAA

Full Affymetrix probeset data:

Annotations for 1638981_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720