Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638983_at:

>probe:Drosophila_2:1638983_at:260:453; Interrogation_Position=11476; Antisense; GATCAGCTCACTGGTCGTCAGAAGC
>probe:Drosophila_2:1638983_at:345:571; Interrogation_Position=11547; Antisense; GGCTTCGTGTACCATAATCCAGACT
>probe:Drosophila_2:1638983_at:413:545; Interrogation_Position=11646; Antisense; GGATCTCTACGGCATAGTTCACCAG
>probe:Drosophila_2:1638983_at:422:93; Interrogation_Position=11661; Antisense; AGTTCACCAGACTTTGTCGCAGATG
>probe:Drosophila_2:1638983_at:211:503; Interrogation_Position=11676; Antisense; GTCGCAGATGCATGCCTGGCTTAAG
>probe:Drosophila_2:1638983_at:444:547; Interrogation_Position=11715; Antisense; GGATGGCAGCACTCTGAGAACTCTG
>probe:Drosophila_2:1638983_at:254:351; Interrogation_Position=11748; Antisense; GCAGATTCCTGCCAGTTGGCTTAAA
>probe:Drosophila_2:1638983_at:257:653; Interrogation_Position=11769; Antisense; TAAACTATGGCCTGGACCTGGCAGC
>probe:Drosophila_2:1638983_at:401:689; Interrogation_Position=11811; Antisense; TTTAAGAGCCCTAATCGTTCGAGCC
>probe:Drosophila_2:1638983_at:179:625; Interrogation_Position=11841; Antisense; TGCCGAACTTCGATTCCGGGAGCAA
>probe:Drosophila_2:1638983_at:309:459; Interrogation_Position=11887; Antisense; GATATCAATTTCGTCCAGGTGTTTA
>probe:Drosophila_2:1638983_at:246:381; Interrogation_Position=11919; Antisense; GAACCTGTTGTCCTGTTTAAAGCTG
>probe:Drosophila_2:1638983_at:598:387; Interrogation_Position=11954; Antisense; GAAAACTGGCAGTTTCCACCGAACG
>probe:Drosophila_2:1638983_at:356:147; Interrogation_Position=11992; Antisense; ACTTGCGGCTCCTCAAACTTGGAAA

Paste this into a BLAST search page for me
GATCAGCTCACTGGTCGTCAGAAGCGGCTTCGTGTACCATAATCCAGACTGGATCTCTACGGCATAGTTCACCAGAGTTCACCAGACTTTGTCGCAGATGGTCGCAGATGCATGCCTGGCTTAAGGGATGGCAGCACTCTGAGAACTCTGGCAGATTCCTGCCAGTTGGCTTAAATAAACTATGGCCTGGACCTGGCAGCTTTAAGAGCCCTAATCGTTCGAGCCTGCCGAACTTCGATTCCGGGAGCAAGATATCAATTTCGTCCAGGTGTTTAGAACCTGTTGTCCTGTTTAAAGCTGGAAAACTGGCAGTTTCCACCGAACGACTTGCGGCTCCTCAAACTTGGAAA

Full Affymetrix probeset data:

Annotations for 1638983_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime