FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638985_at:

>probe:Drosophila_2:1638985_at:4:405; Interrogation_Position=121; Antisense; GACTCGTCCTGCGTCGTCCAGAAGG
>probe:Drosophila_2:1638985_at:275:61; Interrogation_Position=13; Antisense; ATGTCGTTGCTGCTGCTCCTTTTGG
>probe:Drosophila_2:1638985_at:548:637; Interrogation_Position=134; Antisense; TCGTCCAGAAGGCTCCCATCAATGC
>probe:Drosophila_2:1638985_at:722:313; Interrogation_Position=157; Antisense; GCCATCATCGAGGATCTCAGCGACA
>probe:Drosophila_2:1638985_at:536:77; Interrogation_Position=167; Antisense; AGGATCTCAGCGACAAGCCCTGCTA
>probe:Drosophila_2:1638985_at:587:397; Interrogation_Position=178; Antisense; GACAAGCCCTGCTACTGTGACCACG
>probe:Drosophila_2:1638985_at:74:283; Interrogation_Position=204; Antisense; CTGCCTCAAGCTCGGCGATTGCTGC
>probe:Drosophila_2:1638985_at:200:327; Interrogation_Position=218; Antisense; GCGATTGCTGCGACGACTTCAAGGA
>probe:Drosophila_2:1638985_at:40:411; Interrogation_Position=229; Antisense; GACGACTTCAAGGATCACTGTGGAG
>probe:Drosophila_2:1638985_at:95:455; Interrogation_Position=241; Antisense; GATCACTGTGGAGCTCGTGCAAAAC
>probe:Drosophila_2:1638985_at:356:701; Interrogation_Position=32; Antisense; TTTTGGCCGTCATCCTGCCGCAGCG
>probe:Drosophila_2:1638985_at:345:117; Interrogation_Position=59; Antisense; AGCTTCTGCCCTTCGTATCCGGAGG
>probe:Drosophila_2:1638985_at:650:275; Interrogation_Position=69; Antisense; CTTCGTATCCGGAGGGTCCTGCCGG
>probe:Drosophila_2:1638985_at:161:439; Interrogation_Position=94; Antisense; GAGGCGCAGCTCTGCTGCAACGGCC

Paste this into a BLAST search page for me
GACTCGTCCTGCGTCGTCCAGAAGGATGTCGTTGCTGCTGCTCCTTTTGGTCGTCCAGAAGGCTCCCATCAATGCGCCATCATCGAGGATCTCAGCGACAAGGATCTCAGCGACAAGCCCTGCTAGACAAGCCCTGCTACTGTGACCACGCTGCCTCAAGCTCGGCGATTGCTGCGCGATTGCTGCGACGACTTCAAGGAGACGACTTCAAGGATCACTGTGGAGGATCACTGTGGAGCTCGTGCAAAACTTTTGGCCGTCATCCTGCCGCAGCGAGCTTCTGCCCTTCGTATCCGGAGGCTTCGTATCCGGAGGGTCCTGCCGGGAGGCGCAGCTCTGCTGCAACGGCC

Full Affymetrix probeset data:

Annotations for 1638985_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720