Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638986_s_at:

>probe:Drosophila_2:1638986_s_at:379:125; Interrogation_Position=481; Antisense; AGCCAGCGCCAGTGATTTCAATCGG
>probe:Drosophila_2:1638986_s_at:550:17; Interrogation_Position=495; Antisense; ATTTCAATCGGATTCAGTCGGCCGC
>probe:Drosophila_2:1638986_s_at:354:337; Interrogation_Position=521; Antisense; GCTCGGTTGGTTGCCATTCAGGAGT
>probe:Drosophila_2:1638986_s_at:500:577; Interrogation_Position=547; Antisense; GGCCAAGCGCAAGGGTTCCTTCAGT
>probe:Drosophila_2:1638986_s_at:292:101; Interrogation_Position=627; Antisense; AGAGTTTGGCCATGCTCCAGCAAAG
>probe:Drosophila_2:1638986_s_at:124:73; Interrogation_Position=663; Antisense; AGGACTTTAGTGTTCTGCTGCAGCC
>probe:Drosophila_2:1638986_s_at:494:335; Interrogation_Position=679; Antisense; GCTGCAGCCGGACATGTTTGGCAAT
>probe:Drosophila_2:1638986_s_at:282:19; Interrogation_Position=723; Antisense; ATTTCGGGCTAGAGGCCACCAACAA
>probe:Drosophila_2:1638986_s_at:432:235; Interrogation_Position=746; Antisense; AATCCGGCGGACCAGAAGATCGACG
>probe:Drosophila_2:1638986_s_at:158:287; Interrogation_Position=779; Antisense; CTGGACGAGGTCACTGAGCAACAAT
>probe:Drosophila_2:1638986_s_at:582:421; Interrogation_Position=794; Antisense; GAGCAACAATTCTCGCCGGATGAGC
>probe:Drosophila_2:1638986_s_at:723:455; Interrogation_Position=863; Antisense; GATAGTGTGTCCGTAATGGCTCCTA
>probe:Drosophila_2:1638986_s_at:385:215; Interrogation_Position=891; Antisense; AAGATGCCGCCGTGGCTGAGGCAAA
>probe:Drosophila_2:1638986_s_at:307:439; Interrogation_Position=941; Antisense; GAGGCTTCTCTTAATTTACTTCTAT

Paste this into a BLAST search page for me
AGCCAGCGCCAGTGATTTCAATCGGATTTCAATCGGATTCAGTCGGCCGCGCTCGGTTGGTTGCCATTCAGGAGTGGCCAAGCGCAAGGGTTCCTTCAGTAGAGTTTGGCCATGCTCCAGCAAAGAGGACTTTAGTGTTCTGCTGCAGCCGCTGCAGCCGGACATGTTTGGCAATATTTCGGGCTAGAGGCCACCAACAAAATCCGGCGGACCAGAAGATCGACGCTGGACGAGGTCACTGAGCAACAATGAGCAACAATTCTCGCCGGATGAGCGATAGTGTGTCCGTAATGGCTCCTAAAGATGCCGCCGTGGCTGAGGCAAAGAGGCTTCTCTTAATTTACTTCTAT

Full Affymetrix probeset data:

Annotations for 1638986_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime