FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638988_at:

>probe:Drosophila_2:1638988_at:468:261; Interrogation_Position=202; Antisense; CAGCTCTACGGATTTTTCTACCACA
>probe:Drosophila_2:1638988_at:718:181; Interrogation_Position=236; Antisense; AAAAGCCTATGTGGGTGCGGTTATT
>probe:Drosophila_2:1638988_at:563:685; Interrogation_Position=257; Antisense; TATTGGCGGGCCTCTGGACGTACGA
>probe:Drosophila_2:1638988_at:668:21; Interrogation_Position=326; Antisense; ATATAAGCCTCATCCTGTCAATCTT
>probe:Drosophila_2:1638988_at:415:553; Interrogation_Position=449; Antisense; GGAGCGAGCGCATATTTGTCCTCAC
>probe:Drosophila_2:1638988_at:492:677; Interrogation_Position=518; Antisense; TAGAGTTTCCAACCCTGCTAGTATA
>probe:Drosophila_2:1638988_at:182:619; Interrogation_Position=533; Antisense; TGCTAGTATACACCATTCTCTCGAG
>probe:Drosophila_2:1638988_at:465:713; Interrogation_Position=548; Antisense; TTCTCTCGAGCGTGTTTGTCATAGT
>probe:Drosophila_2:1638988_at:650:727; Interrogation_Position=563; Antisense; TTGTCATAGTCTTTGGCGCTTCCAT
>probe:Drosophila_2:1638988_at:551:527; Interrogation_Position=623; Antisense; GGGACTACATACTGATCGGCCAGCT
>probe:Drosophila_2:1638988_at:562:115; Interrogation_Position=644; Antisense; AGCTGTACTACCTCAACTTTTTTGC
>probe:Drosophila_2:1638988_at:236:595; Interrogation_Position=684; Antisense; TGTGTGGACGACAGCCTCGTTTATA
>probe:Drosophila_2:1638988_at:93:441; Interrogation_Position=719; Antisense; GATGGCGCGCGGACATTCATGATAT
>probe:Drosophila_2:1638988_at:561:19; Interrogation_Position=742; Antisense; ATATTCGTGTACCTGTTCTATCGGA

Paste this into a BLAST search page for me
CAGCTCTACGGATTTTTCTACCACAAAAAGCCTATGTGGGTGCGGTTATTTATTGGCGGGCCTCTGGACGTACGAATATAAGCCTCATCCTGTCAATCTTGGAGCGAGCGCATATTTGTCCTCACTAGAGTTTCCAACCCTGCTAGTATATGCTAGTATACACCATTCTCTCGAGTTCTCTCGAGCGTGTTTGTCATAGTTTGTCATAGTCTTTGGCGCTTCCATGGGACTACATACTGATCGGCCAGCTAGCTGTACTACCTCAACTTTTTTGCTGTGTGGACGACAGCCTCGTTTATAGATGGCGCGCGGACATTCATGATATATATTCGTGTACCTGTTCTATCGGA

Full Affymetrix probeset data:

Annotations for 1638988_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720