FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638991_at:

>probe:Drosophila_2:1638991_at:633:369; Interrogation_Position=111; Antisense; GAAGGCTGGTAACCTGTCCTACGTT
>probe:Drosophila_2:1638991_at:246:477; Interrogation_Position=133; Antisense; GTTATTCCCTATAATGCCGTTGTGG
>probe:Drosophila_2:1638991_at:232:45; Interrogation_Position=167; Antisense; ATCCCTACGGATTTACCACCTATGT
>probe:Drosophila_2:1638991_at:89:711; Interrogation_Position=200; Antisense; TTAAGTACTCCAATAGCATCCTGCC
>probe:Drosophila_2:1638991_at:60:317; Interrogation_Position=222; Antisense; GCCGGCTCGAGTTGTTGCGGAAACT
>probe:Drosophila_2:1638991_at:559:331; Interrogation_Position=238; Antisense; GCGGAAACTGGTACTGCTTACTTCA
>probe:Drosophila_2:1638991_at:185:499; Interrogation_Position=292; Antisense; GTCTACGACATCCTAGTGGCTGAGC
>probe:Drosophila_2:1638991_at:554:167; Interrogation_Position=396; Antisense; AAATGAGCGGGTGTTCTGCTGCCGT
>probe:Drosophila_2:1638991_at:474:619; Interrogation_Position=412; Antisense; TGCTGCCGTGCTAAGACCGATGGAG
>probe:Drosophila_2:1638991_at:178:441; Interrogation_Position=430; Antisense; GATGGAGGCATCCTAATCGGCACCC
>probe:Drosophila_2:1638991_at:73:101; Interrogation_Position=494; Antisense; AGAGCTTGGCCCTGCGAAAGTTCGA
>probe:Drosophila_2:1638991_at:328:683; Interrogation_Position=523; Antisense; TATGAAGTTCTGGTGGCCCAGCCTA
>probe:Drosophila_2:1638991_at:524:709; Interrogation_Position=597; Antisense; TTAAGTTCCTTTGATATCCCGGCTC
>probe:Drosophila_2:1638991_at:636:669; Interrogation_Position=73; Antisense; TACGCGGTTCCCTCGACTTATGATA

Paste this into a BLAST search page for me
GAAGGCTGGTAACCTGTCCTACGTTGTTATTCCCTATAATGCCGTTGTGGATCCCTACGGATTTACCACCTATGTTTAAGTACTCCAATAGCATCCTGCCGCCGGCTCGAGTTGTTGCGGAAACTGCGGAAACTGGTACTGCTTACTTCAGTCTACGACATCCTAGTGGCTGAGCAAATGAGCGGGTGTTCTGCTGCCGTTGCTGCCGTGCTAAGACCGATGGAGGATGGAGGCATCCTAATCGGCACCCAGAGCTTGGCCCTGCGAAAGTTCGATATGAAGTTCTGGTGGCCCAGCCTATTAAGTTCCTTTGATATCCCGGCTCTACGCGGTTCCCTCGACTTATGATA

Full Affymetrix probeset data:

Annotations for 1638991_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720