FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638994_at:

>probe:Drosophila_2:1638994_at:290:63; Interrogation_Position=1692; Antisense; ATGTGGTGCGCGTCTATGCCGAAGC
>probe:Drosophila_2:1638994_at:471:681; Interrogation_Position=1706; Antisense; TATGCCGAAGCAGCCACCAAAGAGG
>probe:Drosophila_2:1638994_at:398:557; Interrogation_Position=1729; Antisense; GGACACCGATAATCTTGCCTACGAA
>probe:Drosophila_2:1638994_at:538:37; Interrogation_Position=1740; Antisense; ATCTTGCCTACGAAGTGGGTCTGCT
>probe:Drosophila_2:1638994_at:556:5; Interrogation_Position=1798; Antisense; ATTGACGAAGCCCAACAGCAGTGCC
>probe:Drosophila_2:1638994_at:345:87; Interrogation_Position=1817; Antisense; AGTGCCCACCTGTAGAGCGGAATGA
>probe:Drosophila_2:1638994_at:197:363; Interrogation_Position=1836; Antisense; GAATGACGAACTAACCTCTCACGGG
>probe:Drosophila_2:1638994_at:347:201; Interrogation_Position=1848; Antisense; AACCTCTCACGGGAATCGACAATTG
>probe:Drosophila_2:1638994_at:380:635; Interrogation_Position=1863; Antisense; TCGACAATTGACACAGATCCTGGAT
>probe:Drosophila_2:1638994_at:468:9; Interrogation_Position=1961; Antisense; ATTCTGCAAATGTTCACTGTCTTTT
>probe:Drosophila_2:1638994_at:351:91; Interrogation_Position=2065; Antisense; AGTTGCAATTTTATGTCCTTCGCTA
>probe:Drosophila_2:1638994_at:504:681; Interrogation_Position=2076; Antisense; TATGTCCTTCGCTATTTTGTAATTG
>probe:Drosophila_2:1638994_at:363:231; Interrogation_Position=2115; Antisense; AATGCAACCGCTACGTTGATTTTTT
>probe:Drosophila_2:1638994_at:192:419; Interrogation_Position=2144; Antisense; GAGCTGCTAGCGGTAACTATTGAAA

Paste this into a BLAST search page for me
ATGTGGTGCGCGTCTATGCCGAAGCTATGCCGAAGCAGCCACCAAAGAGGGGACACCGATAATCTTGCCTACGAAATCTTGCCTACGAAGTGGGTCTGCTATTGACGAAGCCCAACAGCAGTGCCAGTGCCCACCTGTAGAGCGGAATGAGAATGACGAACTAACCTCTCACGGGAACCTCTCACGGGAATCGACAATTGTCGACAATTGACACAGATCCTGGATATTCTGCAAATGTTCACTGTCTTTTAGTTGCAATTTTATGTCCTTCGCTATATGTCCTTCGCTATTTTGTAATTGAATGCAACCGCTACGTTGATTTTTTGAGCTGCTAGCGGTAACTATTGAAA

Full Affymetrix probeset data:

Annotations for 1638994_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720