FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638995_at:

>probe:Drosophila_2:1638995_at:245:59; Interrogation_Position=2537; Antisense; ATGTAATGGGCCTGAACTTCCTATT
>probe:Drosophila_2:1638995_at:626:613; Interrogation_Position=2549; Antisense; TGAACTTCCTATTCCTGGTACGGAA
>probe:Drosophila_2:1638995_at:304:83; Interrogation_Position=2576; Antisense; AGGGCTCCTGGCTGGACATCGGTAC
>probe:Drosophila_2:1638995_at:657:151; Interrogation_Position=2591; Antisense; ACATCGGTACGTCCATATCACACTT
>probe:Drosophila_2:1638995_at:519:33; Interrogation_Position=2607; Antisense; ATCACACTTCGTTATCATGGAGGTA
>probe:Drosophila_2:1638995_at:221:493; Interrogation_Position=2629; Antisense; GTAACCACGCTGGTGATGCTCGTGA
>probe:Drosophila_2:1638995_at:61:53; Interrogation_Position=2644; Antisense; ATGCTCGTGATCTTCTATACCGCAA
>probe:Drosophila_2:1638995_at:409:119; Interrogation_Position=2672; Antisense; AGCTGCTGCGAGTGATTCCTTGGGA
>probe:Drosophila_2:1638995_at:240:677; Interrogation_Position=2702; Antisense; TAGACTTCAAAATGTTGCCGCTGCG
>probe:Drosophila_2:1638995_at:89:625; Interrogation_Position=2717; Antisense; TGCCGCTGCGTTTAATCCACTGGGA
>probe:Drosophila_2:1638995_at:402:143; Interrogation_Position=2735; Antisense; ACTGGGATGTGATCAGCGCCAAACA
>probe:Drosophila_2:1638995_at:296:323; Interrogation_Position=2750; Antisense; GCGCCAAACATCACTAGTCCTATAA
>probe:Drosophila_2:1638995_at:680:265; Interrogation_Position=2911; Antisense; CAGGGTGGATCGATTTCATGGACAT
>probe:Drosophila_2:1638995_at:639:641; Interrogation_Position=2998; Antisense; TCTGTACTGTACTGACGCATTTAAG

Paste this into a BLAST search page for me
ATGTAATGGGCCTGAACTTCCTATTTGAACTTCCTATTCCTGGTACGGAAAGGGCTCCTGGCTGGACATCGGTACACATCGGTACGTCCATATCACACTTATCACACTTCGTTATCATGGAGGTAGTAACCACGCTGGTGATGCTCGTGAATGCTCGTGATCTTCTATACCGCAAAGCTGCTGCGAGTGATTCCTTGGGATAGACTTCAAAATGTTGCCGCTGCGTGCCGCTGCGTTTAATCCACTGGGAACTGGGATGTGATCAGCGCCAAACAGCGCCAAACATCACTAGTCCTATAACAGGGTGGATCGATTTCATGGACATTCTGTACTGTACTGACGCATTTAAG

Full Affymetrix probeset data:

Annotations for 1638995_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720