FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638997_at:

>probe:Drosophila_2:1638997_at:272:229; Interrogation_Position=1001; Antisense; AATGGACGCCACGATCGCGAACGAG
>probe:Drosophila_2:1638997_at:359:425; Interrogation_Position=1023; Antisense; GAGAGCGCCAAGATCGCGACAGTAT
>probe:Drosophila_2:1638997_at:307:121; Interrogation_Position=1098; Antisense; AGCGAGAACGTGACCGTGGCCGTCA
>probe:Drosophila_2:1638997_at:88:411; Interrogation_Position=1157; Antisense; GACCGACGACGCTACTAAAATTATA
>probe:Drosophila_2:1638997_at:459:89; Interrogation_Position=618; Antisense; AGTACATTGACGAACTGCTGCGCAA
>probe:Drosophila_2:1638997_at:540:359; Interrogation_Position=639; Antisense; GCAACGACCGTGTCTGCGACATTAT
>probe:Drosophila_2:1638997_at:452:379; Interrogation_Position=679; Antisense; GAAGCGCTCCATTCTCGAGGAAAAC
>probe:Drosophila_2:1638997_at:411:237; Interrogation_Position=709; Antisense; AATCGAGCCCAAGGTGTCAGTGCTG
>probe:Drosophila_2:1638997_at:436:73; Interrogation_Position=738; Antisense; AGGACTTGGACGACGAACTGCCCAG
>probe:Drosophila_2:1638997_at:214:31; Interrogation_Position=778; Antisense; AGACGAGACCAACCGGCCTAAGGAG
>probe:Drosophila_2:1638997_at:493:425; Interrogation_Position=829; Antisense; GAGAGTTCGCTCCAAGTCAAGGTCC
>probe:Drosophila_2:1638997_at:289:563; Interrogation_Position=925; Antisense; GGAAGACTACGACCGCCAGCGAAAT
>probe:Drosophila_2:1638997_at:154:233; Interrogation_Position=959; Antisense; AATCGGGACACCCACAACGAGGACT
>probe:Drosophila_2:1638997_at:675:197; Interrogation_Position=974; Antisense; AACGAGGACTATGACCGTCGGCAAA

Paste this into a BLAST search page for me
AATGGACGCCACGATCGCGAACGAGGAGAGCGCCAAGATCGCGACAGTATAGCGAGAACGTGACCGTGGCCGTCAGACCGACGACGCTACTAAAATTATAAGTACATTGACGAACTGCTGCGCAAGCAACGACCGTGTCTGCGACATTATGAAGCGCTCCATTCTCGAGGAAAACAATCGAGCCCAAGGTGTCAGTGCTGAGGACTTGGACGACGAACTGCCCAGAGACGAGACCAACCGGCCTAAGGAGGAGAGTTCGCTCCAAGTCAAGGTCCGGAAGACTACGACCGCCAGCGAAATAATCGGGACACCCACAACGAGGACTAACGAGGACTATGACCGTCGGCAAA

Full Affymetrix probeset data:

Annotations for 1638997_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720