Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638999_at:

>probe:Drosophila_2:1638999_at:60:347; Interrogation_Position=9076; Antisense; GCACCCCTGCGATTTAAAATAGCCC
>probe:Drosophila_2:1638999_at:296:163; Interrogation_Position=9092; Antisense; AAATAGCCCGGAACTCATCTGGCGG
>probe:Drosophila_2:1638999_at:675:39; Interrogation_Position=9108; Antisense; ATCTGGCGGCGGATACATAATCGGC
>probe:Drosophila_2:1638999_at:406:105; Interrogation_Position=9165; Antisense; AGACAACACGTCTCCGATTACGGAG
>probe:Drosophila_2:1638999_at:272:313; Interrogation_Position=9192; Antisense; GCCACTTATATCACCTCTCAGAGAG
>probe:Drosophila_2:1638999_at:527:265; Interrogation_Position=9210; Antisense; CAGAGAGGCGTCACCACAGGGCAGA
>probe:Drosophila_2:1638999_at:586:143; Interrogation_Position=9234; Antisense; ACTGCTCAACAGTTTTACACCGCAC
>probe:Drosophila_2:1638999_at:104:649; Interrogation_Position=9277; Antisense; TCACCAGCCCTGCTTGGTAAGGACA
>probe:Drosophila_2:1638999_at:240:301; Interrogation_Position=9317; Antisense; CGCCATGCTTGGTGATAGACTCTAG
>probe:Drosophila_2:1638999_at:424:509; Interrogation_Position=9403; Antisense; GTGCAGTCGTCCCTTGTGAATGCGA
>probe:Drosophila_2:1638999_at:240:157; Interrogation_Position=9430; Antisense; ACACCTTTGTGCGTCAACGTGGGAA
>probe:Drosophila_2:1638999_at:553:157; Interrogation_Position=9470; Antisense; ACAACTCATTGCCATCAGCCAGTGG
>probe:Drosophila_2:1638999_at:352:359; Interrogation_Position=9512; Antisense; GCAACTCCTGCAATAGCAACTCGAT
>probe:Drosophila_2:1638999_at:475:371; Interrogation_Position=9574; Antisense; GAAGGCGGCTTACTTCCATTGAAAA

Paste this into a BLAST search page for me
GCACCCCTGCGATTTAAAATAGCCCAAATAGCCCGGAACTCATCTGGCGGATCTGGCGGCGGATACATAATCGGCAGACAACACGTCTCCGATTACGGAGGCCACTTATATCACCTCTCAGAGAGCAGAGAGGCGTCACCACAGGGCAGAACTGCTCAACAGTTTTACACCGCACTCACCAGCCCTGCTTGGTAAGGACACGCCATGCTTGGTGATAGACTCTAGGTGCAGTCGTCCCTTGTGAATGCGAACACCTTTGTGCGTCAACGTGGGAAACAACTCATTGCCATCAGCCAGTGGGCAACTCCTGCAATAGCAACTCGATGAAGGCGGCTTACTTCCATTGAAAA

Full Affymetrix probeset data:

Annotations for 1638999_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime