FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639003_at:

>probe:Drosophila_2:1639003_at:614:523; Interrogation_Position=468; Antisense; GGGCGCCAGTCTTTGTCAACTGAAT
>probe:Drosophila_2:1639003_at:64:97; Interrogation_Position=515; Antisense; AGATCCTTGGGCAGCAACGCATTCA
>probe:Drosophila_2:1639003_at:464:13; Interrogation_Position=535; Antisense; ATTCAATCGGCCGTCTGGACAACAT
>probe:Drosophila_2:1639003_at:408:559; Interrogation_Position=551; Antisense; GGACAACATGCGGTTCCACTTTGCT
>probe:Drosophila_2:1639003_at:39:149; Interrogation_Position=568; Antisense; ACTTTGCTCTATGCGTGTTACGGCA
>probe:Drosophila_2:1639003_at:474:291; Interrogation_Position=600; Antisense; CGTCTACTCATGTACCAGCGATGGT
>probe:Drosophila_2:1639003_at:711:249; Interrogation_Position=653; Antisense; CAATATGGCGCGTTCAGTTGATAAT
>probe:Drosophila_2:1639003_at:174:229; Interrogation_Position=675; Antisense; AATGGATCTGCAGCTTGTGACCACC
>probe:Drosophila_2:1639003_at:690:665; Interrogation_Position=763; Antisense; TACATGGCCAGCATCTTCAAGGAGC
>probe:Drosophila_2:1639003_at:571:641; Interrogation_Position=803; Antisense; TCTGCATTCTGCATACATCGCGATG
>probe:Drosophila_2:1639003_at:687:533; Interrogation_Position=877; Antisense; GGTGACCAATATCCAGCTTACATTT
>probe:Drosophila_2:1639003_at:342:341; Interrogation_Position=892; Antisense; GCTTACATTTCCTTTGGCGTTTTGA
>probe:Drosophila_2:1639003_at:284:365; Interrogation_Position=948; Antisense; GAATACAGGACACTTTCAGCGATAT
>probe:Drosophila_2:1639003_at:484:349; Interrogation_Position=984; Antisense; GCAGTGTTTCAGAGATGCCCAACTA

Paste this into a BLAST search page for me
GGGCGCCAGTCTTTGTCAACTGAATAGATCCTTGGGCAGCAACGCATTCAATTCAATCGGCCGTCTGGACAACATGGACAACATGCGGTTCCACTTTGCTACTTTGCTCTATGCGTGTTACGGCACGTCTACTCATGTACCAGCGATGGTCAATATGGCGCGTTCAGTTGATAATAATGGATCTGCAGCTTGTGACCACCTACATGGCCAGCATCTTCAAGGAGCTCTGCATTCTGCATACATCGCGATGGGTGACCAATATCCAGCTTACATTTGCTTACATTTCCTTTGGCGTTTTGAGAATACAGGACACTTTCAGCGATATGCAGTGTTTCAGAGATGCCCAACTA

Full Affymetrix probeset data:

Annotations for 1639003_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720