FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639004_at:

>probe:Drosophila_2:1639004_at:250:655; Interrogation_Position=1529; Antisense; TAATCATGGATAAGGCGGCGCCCGA
>probe:Drosophila_2:1639004_at:416:157; Interrogation_Position=1561; Antisense; ACACGCACCAAGTCCAAATCGAATG
>probe:Drosophila_2:1639004_at:525:573; Interrogation_Position=1598; Antisense; GGCTGACCATACGTGTAAGTCCCAA
>probe:Drosophila_2:1639004_at:539:215; Interrogation_Position=1614; Antisense; AAGTCCCAACTGAAAATCGCTCCTT
>probe:Drosophila_2:1639004_at:444:387; Interrogation_Position=1625; Antisense; GAAAATCGCTCCTTGCATTTTGCAT
>probe:Drosophila_2:1639004_at:397:345; Interrogation_Position=1639; Antisense; GCATTTTGCATTCCGGACTCCACAT
>probe:Drosophila_2:1639004_at:314:629; Interrogation_Position=1657; Antisense; TCCACATTCCGCATACTGCATAAAC
>probe:Drosophila_2:1639004_at:35:143; Interrogation_Position=1671; Antisense; ACTGCATAAACTGTTCAACGCTTTA
>probe:Drosophila_2:1639004_at:444:703; Interrogation_Position=1693; Antisense; TTATCATTAACTAAGCCCTCAGCTG
>probe:Drosophila_2:1639004_at:479:367; Interrogation_Position=1724; Antisense; GAATCCCATTCACAGCAGACCCAAT
>probe:Drosophila_2:1639004_at:123:239; Interrogation_Position=1746; Antisense; AATCACTCCGAAACTCCGGGCTTTG
>probe:Drosophila_2:1639004_at:227:571; Interrogation_Position=1802; Antisense; GGCTTCAGAAATCACCAGACCAAAC
>probe:Drosophila_2:1639004_at:75:129; Interrogation_Position=1820; Antisense; ACCAAACCATGTCCAGATTCCGATT
>probe:Drosophila_2:1639004_at:296:7; Interrogation_Position=1842; Antisense; ATTCCGGATCCGTGGGACTGCAGAG

Paste this into a BLAST search page for me
TAATCATGGATAAGGCGGCGCCCGAACACGCACCAAGTCCAAATCGAATGGGCTGACCATACGTGTAAGTCCCAAAAGTCCCAACTGAAAATCGCTCCTTGAAAATCGCTCCTTGCATTTTGCATGCATTTTGCATTCCGGACTCCACATTCCACATTCCGCATACTGCATAAACACTGCATAAACTGTTCAACGCTTTATTATCATTAACTAAGCCCTCAGCTGGAATCCCATTCACAGCAGACCCAATAATCACTCCGAAACTCCGGGCTTTGGGCTTCAGAAATCACCAGACCAAACACCAAACCATGTCCAGATTCCGATTATTCCGGATCCGTGGGACTGCAGAG

Full Affymetrix probeset data:

Annotations for 1639004_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720