Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639005_x_at:

>probe:Drosophila_2:1639005_x_at:612:611; Interrogation_Position=14; Antisense; TGAAATACCTTTTCGTGGTTGCCCT
>probe:Drosophila_2:1639005_x_at:545:463; Interrogation_Position=255; Antisense; GATTGTGACCCACAGGAAAAACTAG
>probe:Drosophila_2:1639005_x_at:670:689; Interrogation_Position=39; Antisense; TATTGCCCTGGCCATCCAGATGGCT
>probe:Drosophila_2:1639005_x_at:237:629; Interrogation_Position=53; Antisense; TCCAGATGGCTTCCTCTGCTAGTAA
>probe:Drosophila_2:1639005_x_at:474:307; Interrogation_Position=54; Antisense; CCAGATGGCTTCCTCTGCTAGTAAC
>probe:Drosophila_2:1639005_x_at:464:265; Interrogation_Position=55; Antisense; CAGATGGCTTCCTCTGCTAGTAACA
>probe:Drosophila_2:1639005_x_at:181:99; Interrogation_Position=56; Antisense; AGATGGCTTCCTCTGCTAGTAACAC
>probe:Drosophila_2:1639005_x_at:129:441; Interrogation_Position=57; Antisense; GATGGCTTCCTCTGCTAGTAACACA
>probe:Drosophila_2:1639005_x_at:650:67; Interrogation_Position=58; Antisense; ATGGCTTCCTCTGCTAGTAACACAA
>probe:Drosophila_2:1639005_x_at:13:585; Interrogation_Position=59; Antisense; TGGCTTCCTCTGCTAGTAACACAAC
>probe:Drosophila_2:1639005_x_at:291:571; Interrogation_Position=60; Antisense; GGCTTCCTCTGCTAGTAACACAACA
>probe:Drosophila_2:1639005_x_at:9:345; Interrogation_Position=61; Antisense; GCTTCCTCTGCTAGTAACACAACAA
>probe:Drosophila_2:1639005_x_at:21:631; Interrogation_Position=64; Antisense; TCCTCTGCTAGTAACACAACAACAA
>probe:Drosophila_2:1639005_x_at:392:187; Interrogation_Position=76; Antisense; AACACAACAACAACTGATGCCACCA

Paste this into a BLAST search page for me
TGAAATACCTTTTCGTGGTTGCCCTGATTGTGACCCACAGGAAAAACTAGTATTGCCCTGGCCATCCAGATGGCTTCCAGATGGCTTCCTCTGCTAGTAACCAGATGGCTTCCTCTGCTAGTAACCAGATGGCTTCCTCTGCTAGTAACAAGATGGCTTCCTCTGCTAGTAACACGATGGCTTCCTCTGCTAGTAACACAATGGCTTCCTCTGCTAGTAACACAATGGCTTCCTCTGCTAGTAACACAACGGCTTCCTCTGCTAGTAACACAACAGCTTCCTCTGCTAGTAACACAACAATCCTCTGCTAGTAACACAACAACAAAACACAACAACAACTGATGCCACCA

Full Affymetrix probeset data:

Annotations for 1639005_x_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime