FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639006_at:

>probe:Drosophila_2:1639006_at:252:589; Interrogation_Position=1550; Antisense; TGGAGGTACTGTATGCGTCCCACAA
>probe:Drosophila_2:1639006_at:236:239; Interrogation_Position=1573; Antisense; AATCACGGTTTTCCGCCGCAGAAGA
>probe:Drosophila_2:1639006_at:500:511; Interrogation_Position=1650; Antisense; GTGACTGTGACTAAAGCCAACTTCC
>probe:Drosophila_2:1639006_at:29:1; Interrogation_Position=1667; Antisense; CAACTTCCCCTACAATACAATTTCA
>probe:Drosophila_2:1639006_at:468:157; Interrogation_Position=1699; Antisense; ACAAAACACTTGAAGCCTCCTCTAA
>probe:Drosophila_2:1639006_at:141:307; Interrogation_Position=1714; Antisense; CCTCCTCTAAAACAGCTTGACTTTG
>probe:Drosophila_2:1639006_at:595:125; Interrogation_Position=1786; Antisense; AGCCAACCCAATCCTAGTGGTCAAT
>probe:Drosophila_2:1639006_at:493:545; Interrogation_Position=1820; Antisense; GGATGTAGCCATATTTCCTTCCATT
>probe:Drosophila_2:1639006_at:121:19; Interrogation_Position=1832; Antisense; ATTTCCTTCCATTAACCAAGCTCAA
>probe:Drosophila_2:1639006_at:56:117; Interrogation_Position=1850; Antisense; AGCTCAAAGTTTGCCAGATGCTTAG
>probe:Drosophila_2:1639006_at:169:467; Interrogation_Position=1874; Antisense; GATTGGCTAACACTATTTTCGTTTT
>probe:Drosophila_2:1639006_at:259:201; Interrogation_Position=1910; Antisense; AACGCCTATATGATCTTCCTAACTC
>probe:Drosophila_2:1639006_at:156:429; Interrogation_Position=1986; Antisense; GAGTTCACCATAATGAGGGCCCAAA
>probe:Drosophila_2:1639006_at:124:425; Interrogation_Position=2105; Antisense; GAGAGGTTACGACACACCACGAAGT

Paste this into a BLAST search page for me
TGGAGGTACTGTATGCGTCCCACAAAATCACGGTTTTCCGCCGCAGAAGAGTGACTGTGACTAAAGCCAACTTCCCAACTTCCCCTACAATACAATTTCAACAAAACACTTGAAGCCTCCTCTAACCTCCTCTAAAACAGCTTGACTTTGAGCCAACCCAATCCTAGTGGTCAATGGATGTAGCCATATTTCCTTCCATTATTTCCTTCCATTAACCAAGCTCAAAGCTCAAAGTTTGCCAGATGCTTAGGATTGGCTAACACTATTTTCGTTTTAACGCCTATATGATCTTCCTAACTCGAGTTCACCATAATGAGGGCCCAAAGAGAGGTTACGACACACCACGAAGT

Full Affymetrix probeset data:

Annotations for 1639006_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720