FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639008_at:

>probe:Drosophila_2:1639008_at:445:669; Interrogation_Position=320; Antisense; TACTGACCAGACTTGAGGCACGCCT
>probe:Drosophila_2:1639008_at:165:285; Interrogation_Position=417; Antisense; CTGCACGAGCGGGTCATATGGCTTA
>probe:Drosophila_2:1639008_at:268:709; Interrogation_Position=439; Antisense; TTAAAGCGCTCTCAATCCGATCTAT
>probe:Drosophila_2:1639008_at:602:605; Interrogation_Position=467; Antisense; TGATCCTTAAGTCGAGCTCGGACCT
>probe:Drosophila_2:1639008_at:120:609; Interrogation_Position=491; Antisense; TGAGACTCATCAATTCCTCCAACGA
>probe:Drosophila_2:1639008_at:8:127; Interrogation_Position=595; Antisense; ACCAATATGATAGTCGTGCCCAAGT
>probe:Drosophila_2:1639008_at:81:281; Interrogation_Position=627; Antisense; CTCACTGTTTCTCAACCAGCGAAAG
>probe:Drosophila_2:1639008_at:479:363; Interrogation_Position=652; Antisense; GAATTGAACTCCCAATTGTGCCATT
>probe:Drosophila_2:1639008_at:511:315; Interrogation_Position=671; Antisense; GCCATTGGCGGCATCAATATTCGGA
>probe:Drosophila_2:1639008_at:572:445; Interrogation_Position=705; Antisense; GATGCAGAATTTCCAGAGCAGCTCC
>probe:Drosophila_2:1639008_at:76:305; Interrogation_Position=737; Antisense; CCGAGCGGCGCTTCAAGAATGTGGT
>probe:Drosophila_2:1639008_at:213:425; Interrogation_Position=803; Antisense; GAGACCAGTCAATTTCCACGAGTGC
>probe:Drosophila_2:1639008_at:417:83; Interrogation_Position=829; Antisense; AGTGGCGAGTTTTCCATGACACACC
>probe:Drosophila_2:1639008_at:30:697; Interrogation_Position=888; Antisense; TTTTCGCTTTCACCTGTTGGCCTGA

Paste this into a BLAST search page for me
TACTGACCAGACTTGAGGCACGCCTCTGCACGAGCGGGTCATATGGCTTATTAAAGCGCTCTCAATCCGATCTATTGATCCTTAAGTCGAGCTCGGACCTTGAGACTCATCAATTCCTCCAACGAACCAATATGATAGTCGTGCCCAAGTCTCACTGTTTCTCAACCAGCGAAAGGAATTGAACTCCCAATTGTGCCATTGCCATTGGCGGCATCAATATTCGGAGATGCAGAATTTCCAGAGCAGCTCCCCGAGCGGCGCTTCAAGAATGTGGTGAGACCAGTCAATTTCCACGAGTGCAGTGGCGAGTTTTCCATGACACACCTTTTCGCTTTCACCTGTTGGCCTGA

Full Affymetrix probeset data:

Annotations for 1639008_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720