FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639009_at:

>probe:Drosophila_2:1639009_at:675:699; Interrogation_Position=778; Antisense; TTTATTTCTTTATTTGTCACGCTTG
>probe:Drosophila_2:1639009_at:571:697; Interrogation_Position=782; Antisense; TTTCTTTATTTGTCACGCTTGCTTG
>probe:Drosophila_2:1639009_at:158:689; Interrogation_Position=788; Antisense; TATTTGTCACGCTTGCTTGATTTTA
>probe:Drosophila_2:1639009_at:705:723; Interrogation_Position=791; Antisense; TTGTCACGCTTGCTTGATTTTATTT
>probe:Drosophila_2:1639009_at:522:699; Interrogation_Position=810; Antisense; TTATTTTTAATTATCCGGCGCTGGC
>probe:Drosophila_2:1639009_at:195:17; Interrogation_Position=812; Antisense; ATTTTTAATTATCCGGCGCTGGCTG
>probe:Drosophila_2:1639009_at:580:245; Interrogation_Position=818; Antisense; AATTATCCGGCGCTGGCTGTGAAAA
>probe:Drosophila_2:1639009_at:636:305; Interrogation_Position=824; Antisense; CCGGCGCTGGCTGTGAAAATGAATT
>probe:Drosophila_2:1639009_at:194:573; Interrogation_Position=832; Antisense; GGCTGTGAAAATGAATTCCGCGAAT
>probe:Drosophila_2:1639009_at:108:55; Interrogation_Position=842; Antisense; ATGAATTCCGCGAATGGCAAACCAA
>probe:Drosophila_2:1639009_at:108:719; Interrogation_Position=847; Antisense; TTCCGCGAATGGCAAACCAACATGA
>probe:Drosophila_2:1639009_at:301:565; Interrogation_Position=857; Antisense; GGCAAACCAACATGAACAACCATAA
>probe:Drosophila_2:1639009_at:710:393; Interrogation_Position=883; Antisense; GAAATGCAAAGTCAGCCAAAGCAGC
>probe:Drosophila_2:1639009_at:519:495; Interrogation_Position=893; Antisense; GTCAGCCAAAGCAGCATCAATCCCG

Paste this into a BLAST search page for me
TTTATTTCTTTATTTGTCACGCTTGTTTCTTTATTTGTCACGCTTGCTTGTATTTGTCACGCTTGCTTGATTTTATTGTCACGCTTGCTTGATTTTATTTTTATTTTTAATTATCCGGCGCTGGCATTTTTAATTATCCGGCGCTGGCTGAATTATCCGGCGCTGGCTGTGAAAACCGGCGCTGGCTGTGAAAATGAATTGGCTGTGAAAATGAATTCCGCGAATATGAATTCCGCGAATGGCAAACCAATTCCGCGAATGGCAAACCAACATGAGGCAAACCAACATGAACAACCATAAGAAATGCAAAGTCAGCCAAAGCAGCGTCAGCCAAAGCAGCATCAATCCCG

Full Affymetrix probeset data:

Annotations for 1639009_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720