Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639013_at:

>probe:Drosophila_2:1639013_at:492:727; Interrogation_Position=1307; Antisense; TTGTACGTTTGAATCGGGCACTGTT
>probe:Drosophila_2:1639013_at:603:593; Interrogation_Position=1364; Antisense; TGGGAAATCCCGTGCTGACCACTGT
>probe:Drosophila_2:1639013_at:355:717; Interrogation_Position=1393; Antisense; TTCGGCCTGCCATTGGGATTCTTAT
>probe:Drosophila_2:1639013_at:299:543; Interrogation_Position=1408; Antisense; GGATTCTTATCGCTCATCATGTACT
>probe:Drosophila_2:1639013_at:547:647; Interrogation_Position=1424; Antisense; TCATGTACTCTATTTTCTGCGGCGA
>probe:Drosophila_2:1639013_at:360:283; Interrogation_Position=1440; Antisense; CTGCGGCGATTGCTTGGTCACAGAA
>probe:Drosophila_2:1639013_at:211:451; Interrogation_Position=1572; Antisense; GATCTCATAGTGCATTTCCGAGCAA
>probe:Drosophila_2:1639013_at:449:103; Interrogation_Position=1678; Antisense; AGACCACTTTTCTACCGCATATAAA
>probe:Drosophila_2:1639013_at:77:313; Interrogation_Position=1708; Antisense; GCCAAATCTAGTCCTATGTCAGTGT
>probe:Drosophila_2:1639013_at:306:267; Interrogation_Position=1727; Antisense; CAGTGTATGTCATTGCCGCTTGGCA
>probe:Drosophila_2:1639013_at:498:567; Interrogation_Position=1748; Antisense; GGCACGAACTTCCAATACGCTTTAA
>probe:Drosophila_2:1639013_at:235:673; Interrogation_Position=1763; Antisense; TACGCTTTAAGATTCGCCATCTGAC
>probe:Drosophila_2:1639013_at:163:373; Interrogation_Position=1793; Antisense; GAAGTCCATACGTATTTGGGCATCT
>probe:Drosophila_2:1639013_at:350:593; Interrogation_Position=1809; Antisense; TGGGCATCTAGTTTTGTTTCTCGTT

Paste this into a BLAST search page for me
TTGTACGTTTGAATCGGGCACTGTTTGGGAAATCCCGTGCTGACCACTGTTTCGGCCTGCCATTGGGATTCTTATGGATTCTTATCGCTCATCATGTACTTCATGTACTCTATTTTCTGCGGCGACTGCGGCGATTGCTTGGTCACAGAAGATCTCATAGTGCATTTCCGAGCAAAGACCACTTTTCTACCGCATATAAAGCCAAATCTAGTCCTATGTCAGTGTCAGTGTATGTCATTGCCGCTTGGCAGGCACGAACTTCCAATACGCTTTAATACGCTTTAAGATTCGCCATCTGACGAAGTCCATACGTATTTGGGCATCTTGGGCATCTAGTTTTGTTTCTCGTT

Full Affymetrix probeset data:

Annotations for 1639013_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime