FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639016_at:

>probe:Drosophila_2:1639016_at:602:347; Interrogation_Position=471; Antisense; GCATGGAGCTGGTGTACCGCTGCAA
>probe:Drosophila_2:1639016_at:24:415; Interrogation_Position=520; Antisense; GACCATCAGCGAAGAGGCCTACTAC
>probe:Drosophila_2:1639016_at:84:667; Interrogation_Position=542; Antisense; TACAGCGGCGTGGTGATCCTACAGT
>probe:Drosophila_2:1639016_at:677:395; Interrogation_Position=599; Antisense; GACAATCTGGGACTGTTCACCGGCA
>probe:Drosophila_2:1639016_at:209:713; Interrogation_Position=614; Antisense; TTCACCGGCAGCGATGGCGATAGCA
>probe:Drosophila_2:1639016_at:295:113; Interrogation_Position=635; Antisense; AGCAGCATTAGCTCTGGAATCAGTA
>probe:Drosophila_2:1639016_at:177:365; Interrogation_Position=667; Antisense; GAATATCGACCAGGTGCTGGCCGAC
>probe:Drosophila_2:1639016_at:188:259; Interrogation_Position=699; Antisense; CCCGCGTCCGGGTGATCAAGGTGAA
>probe:Drosophila_2:1639016_at:421:121; Interrogation_Position=726; Antisense; AGCGCGGCGAGCTGATTTAGGAACT
>probe:Drosophila_2:1639016_at:561:433; Interrogation_Position=772; Antisense; GAGGTGAGAACCTGGTGCCGTCAAC
>probe:Drosophila_2:1639016_at:42:495; Interrogation_Position=791; Antisense; GTCAACCTGCGAATCGTGTCTGAGG
>probe:Drosophila_2:1639016_at:584:367; Interrogation_Position=887; Antisense; GAATCCCACATTCTGTTTCCGAGCT
>probe:Drosophila_2:1639016_at:335:693; Interrogation_Position=902; Antisense; TTTCCGAGCTCAGACGGCTGTATAT
>probe:Drosophila_2:1639016_at:113:249; Interrogation_Position=941; Antisense; AATTGTTGATTGTTTCGGGCCGTGA

Paste this into a BLAST search page for me
GCATGGAGCTGGTGTACCGCTGCAAGACCATCAGCGAAGAGGCCTACTACTACAGCGGCGTGGTGATCCTACAGTGACAATCTGGGACTGTTCACCGGCATTCACCGGCAGCGATGGCGATAGCAAGCAGCATTAGCTCTGGAATCAGTAGAATATCGACCAGGTGCTGGCCGACCCCGCGTCCGGGTGATCAAGGTGAAAGCGCGGCGAGCTGATTTAGGAACTGAGGTGAGAACCTGGTGCCGTCAACGTCAACCTGCGAATCGTGTCTGAGGGAATCCCACATTCTGTTTCCGAGCTTTTCCGAGCTCAGACGGCTGTATATAATTGTTGATTGTTTCGGGCCGTGA

Full Affymetrix probeset data:

Annotations for 1639016_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720