Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639019_s_at:

>probe:Drosophila_2:1639019_s_at:483:329; Interrogation_Position=438; Antisense; GCGTGGCCGACGCAGTCCACAGCTT
>probe:Drosophila_2:1639019_s_at:365:409; Interrogation_Position=446; Antisense; GACGCAGTCCACAGCTTCATGTGGC
>probe:Drosophila_2:1639019_s_at:315:87; Interrogation_Position=451; Antisense; AGTCCACAGCTTCATGTGGCACGCC
>probe:Drosophila_2:1639019_s_at:343:63; Interrogation_Position=464; Antisense; ATGTGGCACGCCCAGATCGCACCGT
>probe:Drosophila_2:1639019_s_at:401:261; Interrogation_Position=476; Antisense; CAGATCGCACCGTAACCATTGGTAA
>probe:Drosophila_2:1639019_s_at:302:451; Interrogation_Position=478; Antisense; GATCGCACCGTAACCATTGGTAATG
>probe:Drosophila_2:1639019_s_at:648:129; Interrogation_Position=490; Antisense; ACCATTGGTAATGGCGGCGTCTATA
>probe:Drosophila_2:1639019_s_at:104:539; Interrogation_Position=496; Antisense; GGTAATGGCGGCGTCTATATTCAAC
>probe:Drosophila_2:1639019_s_at:108:229; Interrogation_Position=499; Antisense; AATGGCGGCGTCTATATTCAACGCA
>probe:Drosophila_2:1639019_s_at:625:573; Interrogation_Position=502; Antisense; GGCGGCGTCTATATTCAACGCAGTC
>probe:Drosophila_2:1639019_s_at:70:499; Interrogation_Position=508; Antisense; GTCTATATTCAACGCAGTCGACGCA
>probe:Drosophila_2:1639019_s_at:631:687; Interrogation_Position=511; Antisense; TATATTCAACGCAGTCGACGCAGTC
>probe:Drosophila_2:1639019_s_at:476:689; Interrogation_Position=513; Antisense; TATTCAACGCAGTCGACGCAGTCCA
>probe:Drosophila_2:1639019_s_at:303:135; Interrogation_Position=519; Antisense; ACGCAGTCGACGCAGTCCACAGTTC

Paste this into a BLAST search page for me
GCGTGGCCGACGCAGTCCACAGCTTGACGCAGTCCACAGCTTCATGTGGCAGTCCACAGCTTCATGTGGCACGCCATGTGGCACGCCCAGATCGCACCGTCAGATCGCACCGTAACCATTGGTAAGATCGCACCGTAACCATTGGTAATGACCATTGGTAATGGCGGCGTCTATAGGTAATGGCGGCGTCTATATTCAACAATGGCGGCGTCTATATTCAACGCAGGCGGCGTCTATATTCAACGCAGTCGTCTATATTCAACGCAGTCGACGCATATATTCAACGCAGTCGACGCAGTCTATTCAACGCAGTCGACGCAGTCCAACGCAGTCGACGCAGTCCACAGTTC

Full Affymetrix probeset data:

Annotations for 1639019_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime