FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639022_at:

>probe:Drosophila_2:1639022_at:674:41; Interrogation_Position=211; Antisense; ATCGGTTGCAGGGACACCATGACCT
>probe:Drosophila_2:1639022_at:566:631; Interrogation_Position=235; Antisense; TCCTGGACCACCATGAAAACGCGGT
>probe:Drosophila_2:1639022_at:261:59; Interrogation_Position=303; Antisense; ATGTTCGCAGATAACCGCATCGGTG
>probe:Drosophila_2:1639022_at:347:291; Interrogation_Position=456; Antisense; CGACTGGAAGTTCTTTCACACCAAC
>probe:Drosophila_2:1639022_at:82:563; Interrogation_Position=489; Antisense; GGAACGTGCCCAGAAGATCATCGAA
>probe:Drosophila_2:1639022_at:631:595; Interrogation_Position=536; Antisense; TGTGGGACCGCTTCAGCCGCAATTA
>probe:Drosophila_2:1639022_at:486:245; Interrogation_Position=556; Antisense; AATTACGACTCTTGGCGGGCTCTGC
>probe:Drosophila_2:1639022_at:126:319; Interrogation_Position=601; Antisense; GCCGAGATACGCGACCGGGTCAAGA
>probe:Drosophila_2:1639022_at:5:643; Interrogation_Position=653; Antisense; TCTGTCTGCTGTCGATCGTGGAGAA
>probe:Drosophila_2:1639022_at:403:123; Interrogation_Position=698; Antisense; AGCGCATGTGCCACCTAATGGACGA
>probe:Drosophila_2:1639022_at:695:421; Interrogation_Position=721; Antisense; GAGAAGCGGGACAACTTCACCCAGC
>probe:Drosophila_2:1639022_at:451:119; Interrogation_Position=743; Antisense; AGCTGGTCTTTGAGCGGCCCACGTA
>probe:Drosophila_2:1639022_at:154:323; Interrogation_Position=759; Antisense; GCCCACGTACTTCATGATCGTTGTG
>probe:Drosophila_2:1639022_at:130:43; Interrogation_Position=775; Antisense; ATCGTTGTGCTGTATCTGGTCTATA

Paste this into a BLAST search page for me
ATCGGTTGCAGGGACACCATGACCTTCCTGGACCACCATGAAAACGCGGTATGTTCGCAGATAACCGCATCGGTGCGACTGGAAGTTCTTTCACACCAACGGAACGTGCCCAGAAGATCATCGAATGTGGGACCGCTTCAGCCGCAATTAAATTACGACTCTTGGCGGGCTCTGCGCCGAGATACGCGACCGGGTCAAGATCTGTCTGCTGTCGATCGTGGAGAAAGCGCATGTGCCACCTAATGGACGAGAGAAGCGGGACAACTTCACCCAGCAGCTGGTCTTTGAGCGGCCCACGTAGCCCACGTACTTCATGATCGTTGTGATCGTTGTGCTGTATCTGGTCTATA

Full Affymetrix probeset data:

Annotations for 1639022_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720