Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639024_at:

>probe:Drosophila_2:1639024_at:401:369; Interrogation_Position=1382; Antisense; GAATGCAGCGCTATTCTGCGACTAA
>probe:Drosophila_2:1639024_at:675:663; Interrogation_Position=1404; Antisense; TAAAGGATCTGGACCTGGGCAAGAT
>probe:Drosophila_2:1639024_at:108:565; Interrogation_Position=1421; Antisense; GGCAAGATGGCCACTGCTTACGGTC
>probe:Drosophila_2:1639024_at:106:195; Interrogation_Position=1452; Antisense; AACTGCCACGCATGCCGGAGCTAAA
>probe:Drosophila_2:1639024_at:703:169; Interrogation_Position=1474; Antisense; AAAGAACTACCAGGGCGGCGGCTAT
>probe:Drosophila_2:1639024_at:459:581; Interrogation_Position=1500; Antisense; TGGCGCCTGCTTTTGAAGTGGATTT
>probe:Drosophila_2:1639024_at:466:517; Interrogation_Position=1517; Antisense; GTGGATTTATCCAAACTTACCTACA
>probe:Drosophila_2:1639024_at:99:289; Interrogation_Position=1603; Antisense; CTGGCCGGGCCAAAAGCAGCACAAA
>probe:Drosophila_2:1639024_at:389:181; Interrogation_Position=1625; Antisense; AAAAAGCGTGTTGAGTCCTGGGATC
>probe:Drosophila_2:1639024_at:154:173; Interrogation_Position=1759; Antisense; AAAGAGGCAGCAGTTCAGCCAGGAG
>probe:Drosophila_2:1639024_at:220:383; Interrogation_Position=1793; Antisense; GAACTGGCCAGCGATATTCGGCTCT
>probe:Drosophila_2:1639024_at:531:11; Interrogation_Position=1808; Antisense; ATTCGGCTCTTCAAGCGGCTGAAAA
>probe:Drosophila_2:1639024_at:354:127; Interrogation_Position=1864; Antisense; AGCCATGGGCATCGAAGGGAACAAC
>probe:Drosophila_2:1639024_at:528:561; Interrogation_Position=1881; Antisense; GGAACAACGATTGACATACTCTGGG

Paste this into a BLAST search page for me
GAATGCAGCGCTATTCTGCGACTAATAAAGGATCTGGACCTGGGCAAGATGGCAAGATGGCCACTGCTTACGGTCAACTGCCACGCATGCCGGAGCTAAAAAAGAACTACCAGGGCGGCGGCTATTGGCGCCTGCTTTTGAAGTGGATTTGTGGATTTATCCAAACTTACCTACACTGGCCGGGCCAAAAGCAGCACAAAAAAAAGCGTGTTGAGTCCTGGGATCAAAGAGGCAGCAGTTCAGCCAGGAGGAACTGGCCAGCGATATTCGGCTCTATTCGGCTCTTCAAGCGGCTGAAAAAGCCATGGGCATCGAAGGGAACAACGGAACAACGATTGACATACTCTGGG

Full Affymetrix probeset data:

Annotations for 1639024_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime