FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639025_at:

>probe:Drosophila_2:1639025_at:439:401; Interrogation_Position=3362; Antisense; GACATTACGTATGTATAACTCACGC
>probe:Drosophila_2:1639025_at:279:61; Interrogation_Position=3372; Antisense; ATGTATAACTCACGCAGCTATGCTT
>probe:Drosophila_2:1639025_at:90:193; Interrogation_Position=3378; Antisense; AACTCACGCAGCTATGCTTAACTAA
>probe:Drosophila_2:1639025_at:250:297; Interrogation_Position=3384; Antisense; CGCAGCTATGCTTAACTAAATTATA
>probe:Drosophila_2:1639025_at:373:27; Interrogation_Position=3408; Antisense; ATACCATGCATATAATAGCTGAACG
>probe:Drosophila_2:1639025_at:729:271; Interrogation_Position=3416; Antisense; CATATAATAGCTGAACGCTGATCGG
>probe:Drosophila_2:1639025_at:195:393; Interrogation_Position=3572; Antisense; GAAAGCAGTGTAAAAATCATCAGCA
>probe:Drosophila_2:1639025_at:122:643; Interrogation_Position=3588; Antisense; TCATCAGCAAAACGCTAAAACGCAA
>probe:Drosophila_2:1639025_at:654:189; Interrogation_Position=3621; Antisense; AACATTTTATGTGGTGAAGTCTGAA
>probe:Drosophila_2:1639025_at:298:181; Interrogation_Position=3686; Antisense; AAAACACGAATCAACGCGGATTGAA
>probe:Drosophila_2:1639025_at:268:69; Interrogation_Position=3752; Antisense; AGGCGAAAAGTTGCGTTGTATAATT
>probe:Drosophila_2:1639025_at:395:651; Interrogation_Position=3791; Antisense; TAACTTGTATAAGCAAATCCTTGTT
>probe:Drosophila_2:1639025_at:13:483; Interrogation_Position=3797; Antisense; GTATAAGCAAATCCTTGTTTTGTTT
>probe:Drosophila_2:1639025_at:415:11; Interrogation_Position=3830; Antisense; ATTACCTATGTACGTTTATTTAGAT

Paste this into a BLAST search page for me
GACATTACGTATGTATAACTCACGCATGTATAACTCACGCAGCTATGCTTAACTCACGCAGCTATGCTTAACTAACGCAGCTATGCTTAACTAAATTATAATACCATGCATATAATAGCTGAACGCATATAATAGCTGAACGCTGATCGGGAAAGCAGTGTAAAAATCATCAGCATCATCAGCAAAACGCTAAAACGCAAAACATTTTATGTGGTGAAGTCTGAAAAAACACGAATCAACGCGGATTGAAAGGCGAAAAGTTGCGTTGTATAATTTAACTTGTATAAGCAAATCCTTGTTGTATAAGCAAATCCTTGTTTTGTTTATTACCTATGTACGTTTATTTAGAT

Full Affymetrix probeset data:

Annotations for 1639025_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720