Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639029_at:

>probe:Drosophila_2:1639029_at:284:441; Interrogation_Position=1129; Antisense; GATGTCAACGGATTAACGCCGCGAA
>probe:Drosophila_2:1639029_at:353:201; Interrogation_Position=1143; Antisense; AACGCCGCGAAGAAGCCTGTTCAAT
>probe:Drosophila_2:1639029_at:669:357; Interrogation_Position=1175; Antisense; GCAAAATGGCCGGAAGCACCAGCAC
>probe:Drosophila_2:1639029_at:161:633; Interrogation_Position=1200; Antisense; TCCGAAATCCTTTCTCGTCGAGGAA
>probe:Drosophila_2:1639029_at:112:291; Interrogation_Position=1280; Antisense; CGGATATGTCTAGTTCTTTCTGCAA
>probe:Drosophila_2:1639029_at:172:695; Interrogation_Position=1296; Antisense; TTTCTGCAACAACAGCGCAAGGCCG
>probe:Drosophila_2:1639029_at:166:207; Interrogation_Position=1326; Antisense; AAGCTGCAGGCCCACCAGTTTGGTG
>probe:Drosophila_2:1639029_at:311:387; Interrogation_Position=1365; Antisense; GAACAAGTTGCGCAATGGCTCGAAA
>probe:Drosophila_2:1639029_at:509:19; Interrogation_Position=1501; Antisense; ATATTTTTAAATCGTCAGGCCCTGA
>probe:Drosophila_2:1639029_at:182:495; Interrogation_Position=1514; Antisense; GTCAGGCCCTGATAAGTTTAATTTA
>probe:Drosophila_2:1639029_at:541:271; Interrogation_Position=1554; Antisense; CATCGGATTACTTTTTGCCTGCAAT
>probe:Drosophila_2:1639029_at:191:435; Interrogation_Position=1580; Antisense; GAGGGCATATTCAGTTCATCCAGCG
>probe:Drosophila_2:1639029_at:711:645; Interrogation_Position=1595; Antisense; TCATCCAGCGCTATCGGAAGGAAGA
>probe:Drosophila_2:1639029_at:592:371; Interrogation_Position=1611; Antisense; GAAGGAAGACACTCCATCATCATCA

Paste this into a BLAST search page for me
GATGTCAACGGATTAACGCCGCGAAAACGCCGCGAAGAAGCCTGTTCAATGCAAAATGGCCGGAAGCACCAGCACTCCGAAATCCTTTCTCGTCGAGGAACGGATATGTCTAGTTCTTTCTGCAATTTCTGCAACAACAGCGCAAGGCCGAAGCTGCAGGCCCACCAGTTTGGTGGAACAAGTTGCGCAATGGCTCGAAAATATTTTTAAATCGTCAGGCCCTGAGTCAGGCCCTGATAAGTTTAATTTACATCGGATTACTTTTTGCCTGCAATGAGGGCATATTCAGTTCATCCAGCGTCATCCAGCGCTATCGGAAGGAAGAGAAGGAAGACACTCCATCATCATCA

Full Affymetrix probeset data:

Annotations for 1639029_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime