FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639032_at:

>probe:Drosophila_2:1639032_at:164:279; Interrogation_Position=2788; Antisense; CTAGCGGTGGTTACTGCGACTGTGA
>probe:Drosophila_2:1639032_at:127:143; Interrogation_Position=2806; Antisense; ACTGTGAGTCGCATCCACGGAGCGG
>probe:Drosophila_2:1639032_at:504:579; Interrogation_Position=2829; Antisense; GGCCAATATGAACAGCGCTCTGCTG
>probe:Drosophila_2:1639032_at:33:395; Interrogation_Position=2873; Antisense; GAAAGGAGACACAGCTGCGCCGGCT
>probe:Drosophila_2:1639032_at:111:605; Interrogation_Position=2897; Antisense; TGATCATCAACCCAGAGTTCCGCAT
>probe:Drosophila_2:1639032_at:343:137; Interrogation_Position=2927; Antisense; ACGAGCTCCTCGTGAAGAATTGCGA
>probe:Drosophila_2:1639032_at:230:515; Interrogation_Position=3011; Antisense; GTGTCCAGCGGACCATAGACGAGCA
>probe:Drosophila_2:1639032_at:597:603; Interrogation_Position=3053; Antisense; TGTTGGCCCAGTTCTGCCGTAGCAA
>probe:Drosophila_2:1639032_at:702:137; Interrogation_Position=3083; Antisense; ACGAGGCGGCGTTGGATCTCTTTGA
>probe:Drosophila_2:1639032_at:45:645; Interrogation_Position=3101; Antisense; TCTTTGAGCGCTTGGAGGCCGACGA
>probe:Drosophila_2:1639032_at:179:81; Interrogation_Position=3134; Antisense; AGGTGTCGCATGAGTTCCTTCGCAA
>probe:Drosophila_2:1639032_at:367:353; Interrogation_Position=3165; Antisense; GCAGCTGCTGCAGGTGAACCAGGTT
>probe:Drosophila_2:1639032_at:45:469; Interrogation_Position=3187; Antisense; GTTGAAATTCCCAGTACAATCGCCC
>probe:Drosophila_2:1639032_at:249:43; Interrogation_Position=3252; Antisense; ATCGTCGCTCTTATCCTTAGTTATA

Paste this into a BLAST search page for me
CTAGCGGTGGTTACTGCGACTGTGAACTGTGAGTCGCATCCACGGAGCGGGGCCAATATGAACAGCGCTCTGCTGGAAAGGAGACACAGCTGCGCCGGCTTGATCATCAACCCAGAGTTCCGCATACGAGCTCCTCGTGAAGAATTGCGAGTGTCCAGCGGACCATAGACGAGCATGTTGGCCCAGTTCTGCCGTAGCAAACGAGGCGGCGTTGGATCTCTTTGATCTTTGAGCGCTTGGAGGCCGACGAAGGTGTCGCATGAGTTCCTTCGCAAGCAGCTGCTGCAGGTGAACCAGGTTGTTGAAATTCCCAGTACAATCGCCCATCGTCGCTCTTATCCTTAGTTATA

Full Affymetrix probeset data:

Annotations for 1639032_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720