Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639033_at:

>probe:Drosophila_2:1639033_at:609:521; Interrogation_Position=5430; Antisense; GTGGCCTTTGTGGTCTACACCGCCT
>probe:Drosophila_2:1639033_at:64:335; Interrogation_Position=5459; Antisense; GCTGCAGTGCTTCAAGCCGGCGCCA
>probe:Drosophila_2:1639033_at:499:109; Interrogation_Position=5497; Antisense; AGCACCCCAAGCAGTCTTGAATGGT
>probe:Drosophila_2:1639033_at:322:19; Interrogation_Position=5544; Antisense; ATGTACTGAATCACGTTGAACGGCT
>probe:Drosophila_2:1639033_at:553:383; Interrogation_Position=5561; Antisense; GAACGGCTGTCAACTACGATGGAGG
>probe:Drosophila_2:1639033_at:628:549; Interrogation_Position=5581; Antisense; GGAGGGTTTTCGACAAGACACACAA
>probe:Drosophila_2:1639033_at:337:205; Interrogation_Position=5606; Antisense; AAGCGAGCGAACCAAACTTGAAATG
>probe:Drosophila_2:1639033_at:344:663; Interrogation_Position=5672; Antisense; TAAACTGTCATCCAATCGTCTAAAT
>probe:Drosophila_2:1639033_at:581:409; Interrogation_Position=5699; Antisense; GACGCATGAAAACCACTTGTCTGGA
>probe:Drosophila_2:1639033_at:663:499; Interrogation_Position=5717; Antisense; GTCTGGAGACAATCCATTGCTTTTG
>probe:Drosophila_2:1639033_at:365:455; Interrogation_Position=5772; Antisense; GATAAACTCTGATGCTTCCATTAAT
>probe:Drosophila_2:1639033_at:718:157; Interrogation_Position=5822; Antisense; ACACATTTATTTGTCTTCTCACCCG
>probe:Drosophila_2:1639033_at:529:713; Interrogation_Position=5837; Antisense; TTCTCACCCGTGTACATCATGGAAA
>probe:Drosophila_2:1639033_at:77:493; Interrogation_Position=5960; Antisense; GTAACTTATTTACGGCCTATGATAC

Paste this into a BLAST search page for me
GTGGCCTTTGTGGTCTACACCGCCTGCTGCAGTGCTTCAAGCCGGCGCCAAGCACCCCAAGCAGTCTTGAATGGTATGTACTGAATCACGTTGAACGGCTGAACGGCTGTCAACTACGATGGAGGGGAGGGTTTTCGACAAGACACACAAAAGCGAGCGAACCAAACTTGAAATGTAAACTGTCATCCAATCGTCTAAATGACGCATGAAAACCACTTGTCTGGAGTCTGGAGACAATCCATTGCTTTTGGATAAACTCTGATGCTTCCATTAATACACATTTATTTGTCTTCTCACCCGTTCTCACCCGTGTACATCATGGAAAGTAACTTATTTACGGCCTATGATAC

Full Affymetrix probeset data:

Annotations for 1639033_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime