FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639034_at:

>probe:Drosophila_2:1639034_at:13:365; Interrogation_Position=187; Antisense; GAATTCAAACTCATCTGCCGAGCGA
>probe:Drosophila_2:1639034_at:648:289; Interrogation_Position=215; Antisense; CGGATGCGGACTCCAAACTGCTGAA
>probe:Drosophila_2:1639034_at:693:517; Interrogation_Position=268; Antisense; GTGGGACCCTATTACAAGCAACTCA
>probe:Drosophila_2:1639034_at:206:613; Interrogation_Position=329; Antisense; TGAACAAGAACTGGGCTCGCTACTT
>probe:Drosophila_2:1639034_at:670:107; Interrogation_Position=377; Antisense; AGAACGTGGCCTACGCAATGTTCCG
>probe:Drosophila_2:1639034_at:291:231; Interrogation_Position=393; Antisense; AATGTTCCGCTTCGACATGGATCAC
>probe:Drosophila_2:1639034_at:3:527; Interrogation_Position=419; Antisense; GGGACTGTGTCCTGTATTGTTACGA
>probe:Drosophila_2:1639034_at:619:467; Interrogation_Position=486; Antisense; GTTCATCATGAGCACTTTGGAGGAC
>probe:Drosophila_2:1639034_at:441:323; Interrogation_Position=512; Antisense; GCGCTCGCCTGTGGCATCTGGAAAA
>probe:Drosophila_2:1639034_at:451:79; Interrogation_Position=536; Antisense; AGGTCATGCTGACCGTTCTCAACAA
>probe:Drosophila_2:1639034_at:316:629; Interrogation_Position=571; Antisense; TCCATTTCCTTCTTCAAGCAACTGG
>probe:Drosophila_2:1639034_at:61:111; Interrogation_Position=587; Antisense; AGCAACTGGGCTACGTCAAGGACGA
>probe:Drosophila_2:1639034_at:200:427; Interrogation_Position=610; Antisense; GAGATCTCGCCAGATGTCCTGGAAC
>probe:Drosophila_2:1639034_at:552:561; Interrogation_Position=630; Antisense; GGAACAAGCCGACTACCAAATCTTT

Paste this into a BLAST search page for me
GAATTCAAACTCATCTGCCGAGCGACGGATGCGGACTCCAAACTGCTGAAGTGGGACCCTATTACAAGCAACTCATGAACAAGAACTGGGCTCGCTACTTAGAACGTGGCCTACGCAATGTTCCGAATGTTCCGCTTCGACATGGATCACGGGACTGTGTCCTGTATTGTTACGAGTTCATCATGAGCACTTTGGAGGACGCGCTCGCCTGTGGCATCTGGAAAAAGGTCATGCTGACCGTTCTCAACAATCCATTTCCTTCTTCAAGCAACTGGAGCAACTGGGCTACGTCAAGGACGAGAGATCTCGCCAGATGTCCTGGAACGGAACAAGCCGACTACCAAATCTTT

Full Affymetrix probeset data:

Annotations for 1639034_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720