FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639035_at:

>probe:Drosophila_2:1639035_at:678:215; Interrogation_Position=202; Antisense; AAGATCAACCGTGAATCTCTGGCCA
>probe:Drosophila_2:1639035_at:515:225; Interrogation_Position=247; Antisense; AAGGCGTACTCTGTCGGCGAAGTGA
>probe:Drosophila_2:1639035_at:7:373; Interrogation_Position=265; Antisense; GAAGTGATTGCTGCGAAATGCCCCA
>probe:Drosophila_2:1639035_at:173:295; Interrogation_Position=318; Antisense; CGAGTGCATGAGTCGCGTGCGATTC
>probe:Drosophila_2:1639035_at:692:507; Interrogation_Position=334; Antisense; GTGCGATTCCTCAACTGTTTTGCAA
>probe:Drosophila_2:1639035_at:392:199; Interrogation_Position=358; Antisense; AACGATGATGTTTCCACGTCGCTAA
>probe:Drosophila_2:1639035_at:684:469; Interrogation_Position=427; Antisense; GTTGCCATGGACACACTCAGCGAAT
>probe:Drosophila_2:1639035_at:190:423; Interrogation_Position=483; Antisense; GAGAATGTCCATGTATCGCCACTAT
>probe:Drosophila_2:1639035_at:139:71; Interrogation_Position=518; Antisense; AGGCGCGCCTGGAGAAGCTCTGCAA
>probe:Drosophila_2:1639035_at:555:639; Interrogation_Position=554; Antisense; TCTGCGGCATGTACACGGTGGAGTC
>probe:Drosophila_2:1639035_at:502:519; Interrogation_Position=571; Antisense; GTGGAGTCTGCCTTTCTGGAGAATC
>probe:Drosophila_2:1639035_at:438:389; Interrogation_Position=604; Antisense; GAAAACTTGCCCGAGGCTGGCATAA
>probe:Drosophila_2:1639035_at:703:97; Interrogation_Position=662; Antisense; AGATCCTCTTGAATGGACTGCCGCT
>probe:Drosophila_2:1639035_at:275:145; Interrogation_Position=678; Antisense; ACTGCCGCTGTCGTTTAGCAATGGA

Paste this into a BLAST search page for me
AAGATCAACCGTGAATCTCTGGCCAAAGGCGTACTCTGTCGGCGAAGTGAGAAGTGATTGCTGCGAAATGCCCCACGAGTGCATGAGTCGCGTGCGATTCGTGCGATTCCTCAACTGTTTTGCAAAACGATGATGTTTCCACGTCGCTAAGTTGCCATGGACACACTCAGCGAATGAGAATGTCCATGTATCGCCACTATAGGCGCGCCTGGAGAAGCTCTGCAATCTGCGGCATGTACACGGTGGAGTCGTGGAGTCTGCCTTTCTGGAGAATCGAAAACTTGCCCGAGGCTGGCATAAAGATCCTCTTGAATGGACTGCCGCTACTGCCGCTGTCGTTTAGCAATGGA

Full Affymetrix probeset data:

Annotations for 1639035_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720