FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639036_at:

>probe:Drosophila_2:1639036_at:126:659; Interrogation_Position=597; Antisense; TAACCATGGGTTTTCTCCAGTTCTT
>probe:Drosophila_2:1639036_at:578:63; Interrogation_Position=602; Antisense; ATGGGTTTTCTCCAGTTCTTCTCTC
>probe:Drosophila_2:1639036_at:246:697; Interrogation_Position=607; Antisense; TTTTCTCCAGTTCTTCTCTCAGTTT
>probe:Drosophila_2:1639036_at:19:267; Interrogation_Position=614; Antisense; CAGTTCTTCTCTCAGTTTCCACAGC
>probe:Drosophila_2:1639036_at:392:647; Interrogation_Position=625; Antisense; TCAGTTTCCACAGCATTTCAGCAGT
>probe:Drosophila_2:1639036_at:16:481; Interrogation_Position=628; Antisense; GTTTCCACAGCATTTCAGCAGTCGT
>probe:Drosophila_2:1639036_at:155:117; Interrogation_Position=636; Antisense; AGCATTTCAGCAGTCGTGCAGCCAG
>probe:Drosophila_2:1639036_at:518:17; Interrogation_Position=639; Antisense; ATTTCAGCAGTCGTGCAGCCAGCTA
>probe:Drosophila_2:1639036_at:120:89; Interrogation_Position=647; Antisense; AGTCGTGCAGCCAGCTATTCCATTA
>probe:Drosophila_2:1639036_at:31:511; Interrogation_Position=651; Antisense; GTGCAGCCAGCTATTCCATTAAAAG
>probe:Drosophila_2:1639036_at:339:353; Interrogation_Position=653; Antisense; GCAGCCAGCTATTCCATTAAAAGAA
>probe:Drosophila_2:1639036_at:334:209; Interrogation_Position=673; Antisense; AAGAAACTAAAGATGACCGCAAGAA
>probe:Drosophila_2:1639036_at:655:411; Interrogation_Position=687; Antisense; GACCGCAAGAATATGGACACGAATT
>probe:Drosophila_2:1639036_at:132:557; Interrogation_Position=701; Antisense; GGACACGAATTGCATTGAATGTACA

Paste this into a BLAST search page for me
TAACCATGGGTTTTCTCCAGTTCTTATGGGTTTTCTCCAGTTCTTCTCTCTTTTCTCCAGTTCTTCTCTCAGTTTCAGTTCTTCTCTCAGTTTCCACAGCTCAGTTTCCACAGCATTTCAGCAGTGTTTCCACAGCATTTCAGCAGTCGTAGCATTTCAGCAGTCGTGCAGCCAGATTTCAGCAGTCGTGCAGCCAGCTAAGTCGTGCAGCCAGCTATTCCATTAGTGCAGCCAGCTATTCCATTAAAAGGCAGCCAGCTATTCCATTAAAAGAAAAGAAACTAAAGATGACCGCAAGAAGACCGCAAGAATATGGACACGAATTGGACACGAATTGCATTGAATGTACA

Full Affymetrix probeset data:

Annotations for 1639036_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720