FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639037_at:

>probe:Drosophila_2:1639037_at:606:367; Interrogation_Position=1002; Antisense; GAATCCCGAGCTTCTCGATAAGCTG
>probe:Drosophila_2:1639037_at:310:375; Interrogation_Position=1038; Antisense; GAAGATTGTGTTTACGCCGTGCAAA
>probe:Drosophila_2:1639037_at:446:7; Interrogation_Position=1066; Antisense; ATTCCCGGTCAAATTACGTCTAGCT
>probe:Drosophila_2:1639037_at:604:605; Interrogation_Position=1095; Antisense; TGATCGTTTCATTTTGCAGCTGGCA
>probe:Drosophila_2:1639037_at:42:671; Interrogation_Position=1120; Antisense; TACGAAAAGAATGCCGCCGTGGTTT
>probe:Drosophila_2:1639037_at:494:365; Interrogation_Position=1203; Antisense; GAATCGAGTTCTTGGTTACTCCTGG
>probe:Drosophila_2:1639037_at:74:475; Interrogation_Position=1217; Antisense; GTTACTCCTGGTGCGACAACATATT
>probe:Drosophila_2:1639037_at:328:409; Interrogation_Position=1274; Antisense; GACCTACCCTCGACGAAATTTTGAG
>probe:Drosophila_2:1639037_at:641:369; Interrogation_Position=726; Antisense; GAATGACAGCTTCTTCACCACTGAA
>probe:Drosophila_2:1639037_at:619:127; Interrogation_Position=778; Antisense; ACCAACACATTTAATCCCACGGAGG
>probe:Drosophila_2:1639037_at:532:65; Interrogation_Position=857; Antisense; ATGGTAGCAATGTCGCCTTTGCTCA
>probe:Drosophila_2:1639037_at:194:339; Interrogation_Position=877; Antisense; GCTCATGGCAACTCAAACGTGTTTT
>probe:Drosophila_2:1639037_at:517:223; Interrogation_Position=958; Antisense; AAGGCTGTGGTTCCAATGTTCCGGA
>probe:Drosophila_2:1639037_at:208:159; Interrogation_Position=986; Antisense; ACAACTTCAAGTCTTCGAATCCCGA

Paste this into a BLAST search page for me
GAATCCCGAGCTTCTCGATAAGCTGGAAGATTGTGTTTACGCCGTGCAAAATTCCCGGTCAAATTACGTCTAGCTTGATCGTTTCATTTTGCAGCTGGCATACGAAAAGAATGCCGCCGTGGTTTGAATCGAGTTCTTGGTTACTCCTGGGTTACTCCTGGTGCGACAACATATTGACCTACCCTCGACGAAATTTTGAGGAATGACAGCTTCTTCACCACTGAAACCAACACATTTAATCCCACGGAGGATGGTAGCAATGTCGCCTTTGCTCAGCTCATGGCAACTCAAACGTGTTTTAAGGCTGTGGTTCCAATGTTCCGGAACAACTTCAAGTCTTCGAATCCCGA

Full Affymetrix probeset data:

Annotations for 1639037_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720