FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639038_at:

>probe:Drosophila_2:1639038_at:325:127; Interrogation_Position=1819; Antisense; AGCCAAGGAGAGATGGCGCCCTTCT
>probe:Drosophila_2:1639038_at:165:67; Interrogation_Position=1831; Antisense; ATGGCGCCCTTCTACTTCAAGAAAG
>probe:Drosophila_2:1639038_at:455:81; Interrogation_Position=1940; Antisense; AGGGCCTGCCCTACGTATGGGTTCA
>probe:Drosophila_2:1639038_at:168:681; Interrogation_Position=1955; Antisense; TATGGGTTCACTTCGGCATGGATTC
>probe:Drosophila_2:1639038_at:156:65; Interrogation_Position=1972; Antisense; ATGGATTCGGGCTTCGCGCACGTCA
>probe:Drosophila_2:1639038_at:53:407; Interrogation_Position=2002; Antisense; GACGAGGATCGATTTCCGGCTAACT
>probe:Drosophila_2:1639038_at:601:335; Interrogation_Position=2020; Antisense; GCTAACTTTGCCCAGGAAATCCTCG
>probe:Drosophila_2:1639038_at:211:167; Interrogation_Position=2036; Antisense; AAATCCTCGGCGGAATGCTGGAGTT
>probe:Drosophila_2:1639038_at:371:165; Interrogation_Position=2061; Antisense; AAATCCCAATGCTTGGCGAAAGCCG
>probe:Drosophila_2:1639038_at:440:437; Interrogation_Position=2092; Antisense; GAGGCAAACCCCATCGGAAAGGTGA
>probe:Drosophila_2:1639038_at:722:79; Interrogation_Position=2111; Antisense; AGGTGAAATCCTTTGCTGAAAACTG
>probe:Drosophila_2:1639038_at:592:395; Interrogation_Position=2139; Antisense; GAAATTTGATTGCACACAGAACTAG
>probe:Drosophila_2:1639038_at:670:111; Interrogation_Position=2304; Antisense; AGCACTAATCGATTTGTATTTCCCC
>probe:Drosophila_2:1639038_at:569:481; Interrogation_Position=2335; Antisense; GTATTTCGCAACACTGGTAAACAGC

Paste this into a BLAST search page for me
AGCCAAGGAGAGATGGCGCCCTTCTATGGCGCCCTTCTACTTCAAGAAAGAGGGCCTGCCCTACGTATGGGTTCATATGGGTTCACTTCGGCATGGATTCATGGATTCGGGCTTCGCGCACGTCAGACGAGGATCGATTTCCGGCTAACTGCTAACTTTGCCCAGGAAATCCTCGAAATCCTCGGCGGAATGCTGGAGTTAAATCCCAATGCTTGGCGAAAGCCGGAGGCAAACCCCATCGGAAAGGTGAAGGTGAAATCCTTTGCTGAAAACTGGAAATTTGATTGCACACAGAACTAGAGCACTAATCGATTTGTATTTCCCCGTATTTCGCAACACTGGTAAACAGC

Full Affymetrix probeset data:

Annotations for 1639038_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720