FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639039_at:

>probe:Drosophila_2:1639039_at:591:505; Interrogation_Position=219; Antisense; GTCCAGTGCCAGCAAGCGATCCAAT
>probe:Drosophila_2:1639039_at:729:205; Interrogation_Position=232; Antisense; AAGCGATCCAATCGATCCGTGGGCC
>probe:Drosophila_2:1639039_at:12:43; Interrogation_Position=263; Antisense; ATCGAGGTTCGATTGCGCAGGACAC
>probe:Drosophila_2:1639039_at:39:227; Interrogation_Position=288; Antisense; AAGGCGACGCTACTACTTTGGCAGC
>probe:Drosophila_2:1639039_at:449:225; Interrogation_Position=313; Antisense; AAGGACATCTACTGGTGCAAGCAGA
>probe:Drosophila_2:1639039_at:423:631; Interrogation_Position=365; Antisense; TCTCGGGCTCGGGACTAACGCGTAG
>probe:Drosophila_2:1639039_at:247:279; Interrogation_Position=379; Antisense; CTAACGCGTAGTGCCAGCAGTGTCA
>probe:Drosophila_2:1639039_at:212:115; Interrogation_Position=394; Antisense; AGCAGTGTCACCCACAAGGAAGCGT
>probe:Drosophila_2:1639039_at:487:141; Interrogation_Position=436; Antisense; ACTGGTGGTCAGGTAATCTCCCGTG
>probe:Drosophila_2:1639039_at:251:575; Interrogation_Position=521; Antisense; GGCGTGAGTTTTACTTCTGCGACAA
>probe:Drosophila_2:1639039_at:491:397; Interrogation_Position=541; Antisense; GACAAGTATGCACCTGGTCCAGCAA
>probe:Drosophila_2:1639039_at:536:591; Interrogation_Position=555; Antisense; TGGTCCAGCAAGAAGTACTCCTACT
>probe:Drosophila_2:1639039_at:174:623; Interrogation_Position=653; Antisense; TGCGGTGCGCACATCGAAAGTTCCA
>probe:Drosophila_2:1639039_at:412:311; Interrogation_Position=780; Antisense; GCCACCCATTGCCAGTTCGGAGGAG

Paste this into a BLAST search page for me
GTCCAGTGCCAGCAAGCGATCCAATAAGCGATCCAATCGATCCGTGGGCCATCGAGGTTCGATTGCGCAGGACACAAGGCGACGCTACTACTTTGGCAGCAAGGACATCTACTGGTGCAAGCAGATCTCGGGCTCGGGACTAACGCGTAGCTAACGCGTAGTGCCAGCAGTGTCAAGCAGTGTCACCCACAAGGAAGCGTACTGGTGGTCAGGTAATCTCCCGTGGGCGTGAGTTTTACTTCTGCGACAAGACAAGTATGCACCTGGTCCAGCAATGGTCCAGCAAGAAGTACTCCTACTTGCGGTGCGCACATCGAAAGTTCCAGCCACCCATTGCCAGTTCGGAGGAG

Full Affymetrix probeset data:

Annotations for 1639039_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720