Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639042_at:

>probe:Drosophila_2:1639042_at:725:563; Interrogation_Position=1324; Antisense; GGAATCGATGAGTACTTGCGCCTCC
>probe:Drosophila_2:1639042_at:297:637; Interrogation_Position=1391; Antisense; TCGATCACAAGGGAGCTGCCAGTTT
>probe:Drosophila_2:1639042_at:149:251; Interrogation_Position=1428; Antisense; CAAGGGCGGCCGAAACGAGTTCTAT
>probe:Drosophila_2:1639042_at:312:49; Interrogation_Position=1463; Antisense; ATGCCGAGGAGCTCCAGTACTTGTT
>probe:Drosophila_2:1639042_at:518:91; Interrogation_Position=1502; Antisense; AGTTATTTGTGAGTGCGGTGCCGAC
>probe:Drosophila_2:1639042_at:132:385; Interrogation_Position=1540; Antisense; GAACTCCGCGAATTAATGCTCCATC
>probe:Drosophila_2:1639042_at:411:629; Interrogation_Position=1559; Antisense; TCCATCTGTGGGTTAGCTTTGCGAA
>probe:Drosophila_2:1639042_at:472:565; Interrogation_Position=1588; Antisense; GGCAATCCAAATCCCACGAATGTTA
>probe:Drosophila_2:1639042_at:494:369; Interrogation_Position=1605; Antisense; GAATGTTAGCTTTCATCTGCCGAAC
>probe:Drosophila_2:1639042_at:581:301; Interrogation_Position=1637; Antisense; CCGCCTCTAGTTATCCAGTGGAATT
>probe:Drosophila_2:1639042_at:433:363; Interrogation_Position=1657; Antisense; GAATTCGCTCGACTGGGCACCAAAA
>probe:Drosophila_2:1639042_at:95:633; Interrogation_Position=1690; Antisense; TCCGCATCCATTTTTCGACTTGAAA
>probe:Drosophila_2:1639042_at:301:177; Interrogation_Position=1713; Antisense; AAACGAGCTTATGCAGCACCGGGTC
>probe:Drosophila_2:1639042_at:271:601; Interrogation_Position=1793; Antisense; TGTAGTCGTCCATCAAGTCGTTGTT

Paste this into a BLAST search page for me
GGAATCGATGAGTACTTGCGCCTCCTCGATCACAAGGGAGCTGCCAGTTTCAAGGGCGGCCGAAACGAGTTCTATATGCCGAGGAGCTCCAGTACTTGTTAGTTATTTGTGAGTGCGGTGCCGACGAACTCCGCGAATTAATGCTCCATCTCCATCTGTGGGTTAGCTTTGCGAAGGCAATCCAAATCCCACGAATGTTAGAATGTTAGCTTTCATCTGCCGAACCCGCCTCTAGTTATCCAGTGGAATTGAATTCGCTCGACTGGGCACCAAAATCCGCATCCATTTTTCGACTTGAAAAAACGAGCTTATGCAGCACCGGGTCTGTAGTCGTCCATCAAGTCGTTGTT

Full Affymetrix probeset data:

Annotations for 1639042_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime