Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639044_at:

>probe:Drosophila_2:1639044_at:75:659; Interrogation_Position=1460; Antisense; TAAGCTGCTACATAGTCCGATCGAA
>probe:Drosophila_2:1639044_at:121:227; Interrogation_Position=1490; Antisense; AAGGCAAGAGTGCATCCAGCGGATT
>probe:Drosophila_2:1639044_at:681:345; Interrogation_Position=1501; Antisense; GCATCCAGCGGATTGGGACTCGGTC
>probe:Drosophila_2:1639044_at:361:145; Interrogation_Position=1518; Antisense; ACTCGGTCGGAATCGGGTGCACAGC
>probe:Drosophila_2:1639044_at:591:155; Interrogation_Position=1550; Antisense; ACAGCAGCGTGTCGTCTGCCAATCT
>probe:Drosophila_2:1639044_at:82:629; Interrogation_Position=1566; Antisense; TGCCAATCTCGTTACCCACGAAAAG
>probe:Drosophila_2:1639044_at:670:491; Interrogation_Position=1667; Antisense; GTAACATTACCATGGCCAATCCGAT
>probe:Drosophila_2:1639044_at:217:613; Interrogation_Position=1691; Antisense; TGAACAATGGCTTGCATCACGTGGC
>probe:Drosophila_2:1639044_at:243:265; Interrogation_Position=1725; Antisense; CAGTAGTAGCATGGCCCTCGGTAGT
>probe:Drosophila_2:1639044_at:44:419; Interrogation_Position=1809; Antisense; GAGCTATGCGGCTACAGTGCGCATT
>probe:Drosophila_2:1639044_at:566:419; Interrogation_Position=1879; Antisense; GAGCACGACTCACTGCAGACGGAGA
>probe:Drosophila_2:1639044_at:655:253; Interrogation_Position=1905; Antisense; CAACAATCGGAAAGTGGCAGCCACG
>probe:Drosophila_2:1639044_at:545:447; Interrogation_Position=2005; Antisense; GATGCCATGGGTTCCTCTGAGAACA
>probe:Drosophila_2:1639044_at:529:421; Interrogation_Position=2023; Antisense; GAGAACAACTTGACGGTCTACTTCT

Paste this into a BLAST search page for me
TAAGCTGCTACATAGTCCGATCGAAAAGGCAAGAGTGCATCCAGCGGATTGCATCCAGCGGATTGGGACTCGGTCACTCGGTCGGAATCGGGTGCACAGCACAGCAGCGTGTCGTCTGCCAATCTTGCCAATCTCGTTACCCACGAAAAGGTAACATTACCATGGCCAATCCGATTGAACAATGGCTTGCATCACGTGGCCAGTAGTAGCATGGCCCTCGGTAGTGAGCTATGCGGCTACAGTGCGCATTGAGCACGACTCACTGCAGACGGAGACAACAATCGGAAAGTGGCAGCCACGGATGCCATGGGTTCCTCTGAGAACAGAGAACAACTTGACGGTCTACTTCT

Full Affymetrix probeset data:

Annotations for 1639044_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime