FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639045_at:

>probe:Drosophila_2:1639045_at:74:425; Interrogation_Position=1429; Antisense; GAGACGATCGGCTGGCTAGGCATAT
>probe:Drosophila_2:1639045_at:694:71; Interrogation_Position=1446; Antisense; AGGCATATGCATATTCTTTGCTCCA
>probe:Drosophila_2:1639045_at:369:621; Interrogation_Position=1464; Antisense; TGCTCCAATTGCTTGTACCATTTTG
>probe:Drosophila_2:1639045_at:352:21; Interrogation_Position=1495; Antisense; ATATTCTTCTATGTGACCACCAGGA
>probe:Drosophila_2:1639045_at:289:687; Interrogation_Position=1541; Antisense; TATACGGCCGCATTGCGCACAAATT
>probe:Drosophila_2:1639045_at:114:175; Interrogation_Position=1567; Antisense; AAAGCCAATTTTATCATGTTCTCGC
>probe:Drosophila_2:1639045_at:552:59; Interrogation_Position=1582; Antisense; ATGTTCTCGCTGATGCTGTTAGTAA
>probe:Drosophila_2:1639045_at:181:27; Interrogation_Position=1612; Antisense; ATAGCCTGGCTATTCCTCATAATGT
>probe:Drosophila_2:1639045_at:129:97; Interrogation_Position=1646; Antisense; AGATGGAAGGCCTGCTTTACGCCCA
>probe:Drosophila_2:1639045_at:643:151; Interrogation_Position=1670; Antisense; ACATCGTAGTTAACGCCCTGCAGAC
>probe:Drosophila_2:1639045_at:426:469; Interrogation_Position=1701; Antisense; GTTGCTATACATATGCGTGCTGCGC
>probe:Drosophila_2:1639045_at:248:625; Interrogation_Position=1721; Antisense; TGCGCCAGCGACATGTGACATTTCT
>probe:Drosophila_2:1639045_at:315:213; Interrogation_Position=1753; Antisense; AAGACCTGCTGCTACAATGAGCCAC
>probe:Drosophila_2:1639045_at:154:125; Interrogation_Position=1836; Antisense; AGCCACCGTCCACACTAATATAAGT

Paste this into a BLAST search page for me
GAGACGATCGGCTGGCTAGGCATATAGGCATATGCATATTCTTTGCTCCATGCTCCAATTGCTTGTACCATTTTGATATTCTTCTATGTGACCACCAGGATATACGGCCGCATTGCGCACAAATTAAAGCCAATTTTATCATGTTCTCGCATGTTCTCGCTGATGCTGTTAGTAAATAGCCTGGCTATTCCTCATAATGTAGATGGAAGGCCTGCTTTACGCCCAACATCGTAGTTAACGCCCTGCAGACGTTGCTATACATATGCGTGCTGCGCTGCGCCAGCGACATGTGACATTTCTAAGACCTGCTGCTACAATGAGCCACAGCCACCGTCCACACTAATATAAGT

Full Affymetrix probeset data:

Annotations for 1639045_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720