FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639046_at:

>probe:Drosophila_2:1639046_at:473:577; Interrogation_Position=199; Antisense; GGCCGCAAGCATCGCGACAATGTAA
>probe:Drosophila_2:1639046_at:182:297; Interrogation_Position=257; Antisense; CGCAGCATTTGATTGACGCCACTAC
>probe:Drosophila_2:1639046_at:282:33; Interrogation_Position=304; Antisense; ATCACGAACAATCCGTTTGCCGGCG
>probe:Drosophila_2:1639046_at:286:369; Interrogation_Position=404; Antisense; GAATGCCTGGAATGCCCTATATGCC
>probe:Drosophila_2:1639046_at:652:687; Interrogation_Position=421; Antisense; TATATGCCTCCACTGATGAACCCCA
>probe:Drosophila_2:1639046_at:376:55; Interrogation_Position=436; Antisense; ATGAACCCCATGATGGGCATGCGTC
>probe:Drosophila_2:1639046_at:552:51; Interrogation_Position=454; Antisense; ATGCGTCCGCCACCGATTATGAATC
>probe:Drosophila_2:1639046_at:655:287; Interrogation_Position=522; Antisense; CGGCGTCCGTCCAGGAATCATGAAC
>probe:Drosophila_2:1639046_at:492:29; Interrogation_Position=541; Antisense; ATGAACGGACCCAAGTGAACGCCCT
>probe:Drosophila_2:1639046_at:14:219; Interrogation_Position=553; Antisense; AAGTGAACGCCCTCAGGAACGGCAT
>probe:Drosophila_2:1639046_at:474:287; Interrogation_Position=572; Antisense; CGGCATCAACGTTCACAGCACAGAT
>probe:Drosophila_2:1639046_at:243:155; Interrogation_Position=591; Antisense; ACAGATGGAGTGCTCTCCTTGCGAT
>probe:Drosophila_2:1639046_at:678:333; Interrogation_Position=602; Antisense; GCTCTCCTTGCGATGTCCTAATTAA
>probe:Drosophila_2:1639046_at:405:487; Interrogation_Position=630; Antisense; GTAGCATTTAAGTAAGCCCGATAGC

Paste this into a BLAST search page for me
GGCCGCAAGCATCGCGACAATGTAACGCAGCATTTGATTGACGCCACTACATCACGAACAATCCGTTTGCCGGCGGAATGCCTGGAATGCCCTATATGCCTATATGCCTCCACTGATGAACCCCAATGAACCCCATGATGGGCATGCGTCATGCGTCCGCCACCGATTATGAATCCGGCGTCCGTCCAGGAATCATGAACATGAACGGACCCAAGTGAACGCCCTAAGTGAACGCCCTCAGGAACGGCATCGGCATCAACGTTCACAGCACAGATACAGATGGAGTGCTCTCCTTGCGATGCTCTCCTTGCGATGTCCTAATTAAGTAGCATTTAAGTAAGCCCGATAGC

Full Affymetrix probeset data:

Annotations for 1639046_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720