Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639047_at:

>probe:Drosophila_2:1639047_at:32:383; Interrogation_Position=13656; Antisense; GAACGATAATGTTGCTTGAGATGAT
>probe:Drosophila_2:1639047_at:646:687; Interrogation_Position=13683; Antisense; TATATAATGCTTAGAGAACCCACGC
>probe:Drosophila_2:1639047_at:142:421; Interrogation_Position=13696; Antisense; GAGAACCCACGCATAATCTAATGAC
>probe:Drosophila_2:1639047_at:126:255; Interrogation_Position=13732; Antisense; CAACAAATTCGATGGTTATTGCAAG
>probe:Drosophila_2:1639047_at:582:249; Interrogation_Position=13846; Antisense; CAATGTTTTAGCTGCAAGCAAATAA
>probe:Drosophila_2:1639047_at:374:661; Interrogation_Position=13954; Antisense; TAAACCCAAACACATGCCCGATATG
>probe:Drosophila_2:1639047_at:701:151; Interrogation_Position=13965; Antisense; ACATGCCCGATATGCCCGACAGGAA
>probe:Drosophila_2:1639047_at:550:455; Interrogation_Position=13973; Antisense; GATATGCCCGACAGGAAGTTTATTC
>probe:Drosophila_2:1639047_at:491:561; Interrogation_Position=13986; Antisense; GGAAGTTTATTCGATTTTGTTGATT
>probe:Drosophila_2:1639047_at:709:29; Interrogation_Position=14020; Antisense; ATACAACCGAATATCTGAGGACATA
>probe:Drosophila_2:1639047_at:112:681; Interrogation_Position=14031; Antisense; TATCTGAGGACATACAGCCGTTATG
>probe:Drosophila_2:1639047_at:101:263; Interrogation_Position=14045; Antisense; CAGCCGTTATGAGATGATTGATTAT
>probe:Drosophila_2:1639047_at:254:607; Interrogation_Position=14069; Antisense; TGAGATCCTTGATTGAAACGCAAAC
>probe:Drosophila_2:1639047_at:519:389; Interrogation_Position=14083; Antisense; GAAACGCAAACAAAACGATGGGAAT

Paste this into a BLAST search page for me
GAACGATAATGTTGCTTGAGATGATTATATAATGCTTAGAGAACCCACGCGAGAACCCACGCATAATCTAATGACCAACAAATTCGATGGTTATTGCAAGCAATGTTTTAGCTGCAAGCAAATAATAAACCCAAACACATGCCCGATATGACATGCCCGATATGCCCGACAGGAAGATATGCCCGACAGGAAGTTTATTCGGAAGTTTATTCGATTTTGTTGATTATACAACCGAATATCTGAGGACATATATCTGAGGACATACAGCCGTTATGCAGCCGTTATGAGATGATTGATTATTGAGATCCTTGATTGAAACGCAAACGAAACGCAAACAAAACGATGGGAAT

Full Affymetrix probeset data:

Annotations for 1639047_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime