FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639049_at:

>probe:Drosophila_2:1639049_at:112:667; Interrogation_Position=1033; Antisense; TACACCGCGTGCAAGACGTAGGCAT
>probe:Drosophila_2:1639049_at:281:195; Interrogation_Position=511; Antisense; AACGGCGTAAACTTCGACAATCTGC
>probe:Drosophila_2:1639049_at:509:523; Interrogation_Position=537; Antisense; GGGCTGCAATATGTATCACGTCTGT
>probe:Drosophila_2:1639049_at:164:35; Interrogation_Position=551; Antisense; ATCACGTCTGTGAGAAGGGCGTCCT
>probe:Drosophila_2:1639049_at:629:175; Interrogation_Position=596; Antisense; AAACCTATTATCAGGCCAGCACGGG
>probe:Drosophila_2:1639049_at:240:71; Interrogation_Position=635; Antisense; AGGCTCTGGTGGACTGCGATGCCCA
>probe:Drosophila_2:1639049_at:460:563; Interrogation_Position=682; Antisense; GGCAAGGCCAGTAAGCCCTACGAGA
>probe:Drosophila_2:1639049_at:37:217; Interrogation_Position=709; Antisense; AAGTTCGTCGCGGATGAAGCCACCT
>probe:Drosophila_2:1639049_at:256:517; Interrogation_Position=790; Antisense; GTGTGGAACCAGTGTCCCCAGGACA
>probe:Drosophila_2:1639049_at:689:95; Interrogation_Position=814; Antisense; AGATTCTTCGATGCGAGCAGCCAGA
>probe:Drosophila_2:1639049_at:412:1; Interrogation_Position=884; Antisense; ACGGTCGGACTGCTAGTTTTGTCGT
>probe:Drosophila_2:1639049_at:239:91; Interrogation_Position=898; Antisense; AGTTTTGTCGTTAGTGCCACCAAGG
>probe:Drosophila_2:1639049_at:516:221; Interrogation_Position=919; Antisense; AAGGGCTGTCGCAACTATCTGAGCT
>probe:Drosophila_2:1639049_at:6:123; Interrogation_Position=964; Antisense; AGCGAGAGGTCCTGCGGCAACTACT

Paste this into a BLAST search page for me
TACACCGCGTGCAAGACGTAGGCATAACGGCGTAAACTTCGACAATCTGCGGGCTGCAATATGTATCACGTCTGTATCACGTCTGTGAGAAGGGCGTCCTAAACCTATTATCAGGCCAGCACGGGAGGCTCTGGTGGACTGCGATGCCCAGGCAAGGCCAGTAAGCCCTACGAGAAAGTTCGTCGCGGATGAAGCCACCTGTGTGGAACCAGTGTCCCCAGGACAAGATTCTTCGATGCGAGCAGCCAGAACGGTCGGACTGCTAGTTTTGTCGTAGTTTTGTCGTTAGTGCCACCAAGGAAGGGCTGTCGCAACTATCTGAGCTAGCGAGAGGTCCTGCGGCAACTACT

Full Affymetrix probeset data:

Annotations for 1639049_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720