FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639051_at:

>probe:Drosophila_2:1639051_at:181:137; Interrogation_Position=113; Antisense; ACGAGACCTCTGTGGCCGGAATCAT
>probe:Drosophila_2:1639051_at:76:549; Interrogation_Position=147; Antisense; GGATGGACACATGACCTGCGAGCTC
>probe:Drosophila_2:1639051_at:194:651; Interrogation_Position=170; Antisense; TCACCCATGCAGTTTTCATCGATCG
>probe:Drosophila_2:1639051_at:349:645; Interrogation_Position=185; Antisense; TCATCGATCGCAATGGTGGTCAGCA
>probe:Drosophila_2:1639051_at:667:111; Interrogation_Position=206; Antisense; AGCACCCCTTTGATCACTTTATGGT
>probe:Drosophila_2:1639051_at:191:59; Interrogation_Position=241; Antisense; ATGATACGGCAGATCCACATACCTT
>probe:Drosophila_2:1639051_at:671:95; Interrogation_Position=251; Antisense; AGATCCACATACCTTCGTACTTGGA
>probe:Drosophila_2:1639051_at:641:667; Interrogation_Position=268; Antisense; TACTTGGATGCCGAGCAGGAACTTC
>probe:Drosophila_2:1639051_at:633:71; Interrogation_Position=284; Antisense; AGGAACTTCGAAGCGCAATGGAACG
>probe:Drosophila_2:1639051_at:193:127; Interrogation_Position=337; Antisense; ACCAAGGGCGGAAAGCGGACATTCA
>probe:Drosophila_2:1639051_at:127:121; Interrogation_Position=55; Antisense; ACCTTAAATTGTTGGCCCGTGATGC
>probe:Drosophila_2:1639051_at:633:605; Interrogation_Position=74; Antisense; TGATGCTGCAGGGTCATTCCGTACT
>probe:Drosophila_2:1639051_at:442:9; Interrogation_Position=89; Antisense; ATTCCGTACTGATCGATCTGCACAA
>probe:Drosophila_2:1639051_at:191:451; Interrogation_Position=99; Antisense; GATCGATCTGCACAACGAGACCTCT

Paste this into a BLAST search page for me
ACGAGACCTCTGTGGCCGGAATCATGGATGGACACATGACCTGCGAGCTCTCACCCATGCAGTTTTCATCGATCGTCATCGATCGCAATGGTGGTCAGCAAGCACCCCTTTGATCACTTTATGGTATGATACGGCAGATCCACATACCTTAGATCCACATACCTTCGTACTTGGATACTTGGATGCCGAGCAGGAACTTCAGGAACTTCGAAGCGCAATGGAACGACCAAGGGCGGAAAGCGGACATTCAACCTTAAATTGTTGGCCCGTGATGCTGATGCTGCAGGGTCATTCCGTACTATTCCGTACTGATCGATCTGCACAAGATCGATCTGCACAACGAGACCTCT

Full Affymetrix probeset data:

Annotations for 1639051_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720